El creacionismo hace llorar a mi mono

Este blog nació con el objetivo de desmitificar la existencia los chemtrails, supuestas estelas químicas dejadas por aviones a reacción, que enferman a la población, la controlan mentalmente y la modifican genéticamente (esto SÍ que es Renault Ocasión).

Pero, al fin y al cabo, qué es un blog? Un pequeño espacio en internet donde expones tus ideas, opiniones y vivencias, o ese es la definición más general. Por lo tanto, un artículo sobre mi forma de ver el ateísmo no creo que tuviera nada de malo, aunque no siga la temática general de este blog.

Pues bien, vamos a ello.

Qué es un ateo?

Según la Wikipedia:

El término ateísmo, en su noción etimológica, se refiere a la falta de creencia en la existencia de cualquier dios, que es la definición más aceptada en su propio ámbito filosófico. Sin embargo, existen otras definiciones más o menos amplias del término, en su mayoría surgidas de la cultura popular.

Esa sería una descripción perfectamente válida, pero tenemos que tener en cuenta que hay diferentes tipos de ateísmo, dependiendo de los pensamientos del ateo respecto a la religión y los dioses.

Ateísmo Fuerte o Positivo: esta clase de ateísmo niega la existencia de dioses, apoyándose en razones varias. No da posibilidades gratuitas a la existencia de un ser sobrenatural como es un dios. Por lo tanto, sería correcto decir que para un ateísta (o ateo) fuerte, los dioses no existen hasta que se encuentran pruebas de lo contrario, o un razonamiento lógico que lleve a esa conclusión.

En este grupo se encuentran personajes como Ludwig Feuerbach o Karl Marx.

Ateísmo Débil o Escéptico: los ateos pertenecientes a este grupo no niegan la existencia de Dios, sino que, sencillamente, no la toman como algo real.

Ateísmo agnóstico: este ateísmo no niega explícitamente la existencia de los dioses, sino que niega únicamente el conocimiento de su existencia, y por esta razón, muchos ateístas no los clasifican como ateos.

Uno de los múltiples símbolos del ateísmo.

Ahora que tenemos clara la definición de ateísmo, voy a narrar lo que realmente conozco mejor, mi relación personal con el ateísmo. Aquí empieza mi parrafada autobiográfica, tambiñen conocida como el tocho.

Nací en un estado laico como es España, aunque rodeado de fuertes creencias religiosas. De niño asistí a bodas, comuniones, incluso fui algún día a acompañar a la abuela a misa.

La iglesia me era igual de indiferente que un hospital o un ayuntamiento. Lo veía como un edificio donde la gente decía lo mismo, leyendo un libro, y pensaba que sería por algo.

Un día, cuando ya había madurado algo intelectualmente (entre los 9 y 14 años, no lo recuerdo exactamente), mis padres me contaron qué era la religión. Me dijeron que algunas personas creían en un Dios, algunas en Alá, otras en Jesucristo, y bastantes más.  Me explicaron los milagros que se le atribuían al profeta, qué se hacía en las iglesias, qué era la Biblia, el por qué de las bodas y comuniones a las que había asistido.

También me contaron qué es el bautizo, y que yo no estaba bautizado. Yo ya sabía que no había hecho la comunión, pero también desconocía la razón por las que mis amigos la hacían, recibiendo relojes nuevos, y yo no.

En ese momento me explicaron que ahora ya sabía lo que era la religión, y que si no me habían bautizado ni había hecho la comunión era por la sencilla razón de que querían que yo, cuando creciera, tomara la decisión de hacerlo o no. No quisieron imponerme nada. Pero también me recordaron que, aunque decidiera no creer en ninguna religión, tenía que respetarlas, ya que las creencias son algo que cada uno adopta, y que nadie tiene derecho a imponer las suyas a los demás.

Pasaron los años, y la verdad es que yo no le daba mucha importancia al tema de la religión. Seguí sin bautizar y sin hacer la comunión, pero no era algo que me preocupara. No es que hubiera tomado la decisión de no creer en ningún dios, sencillamente, no había visto por qué tendría que creer. En esos tiempos aún creía en fantasmas y espíritus, supongo que como cualquier niño. Pasaron más años, y el miedo a la oscuridad y a lo que hay bajo la cama se fueron diluyendo progresivamente.

Antes de llegar a la plena madurez psíquica ( o casi…creo que algunas cosas nunca maduran del todo), realmente no le daba importancia a los mormones que venían a llamar a mi puerta, ni a los fanáticos que venían a salvarme del infierno.

Pero desde hace algunos años sí que le doy importancia. Ahora mismo me defino como ateo fuerte, no creo ni en dioses ni en seres paranormales, y niego su existencia. Poco a poco me di cuenta de que la superstición permite a la gente pensar de una forma irracional, que lleva a algo realmente peligroso. Pero antes, se hace necesaria una definición más.

La ciencia.

Realmente, qué es la ciencia? Muchos creyentes que me he encontrado y que me han intentado “alejar de una senda que me lleva derecho al infierno”, creen que para los ateos es como un dios, atribuyéndole cualidades humanas (personificación), llamándola a veces inmoral, aberrante o, sencillamente, mala.

La ciencia (del latín scientia, “conocimiento“) es el conocimiento sistematizado elaborado mediante observaciones, razonamientos y pruebas metódicamente organizados. La ciencia utiliza diferentes métodos y técnicas para la adquisición y organización de conocimientos sobre la estructura de un conjunto de hechos objetivos y accesibles a varios observadores. La aplicación de esos métodos y conocimientos conduce a la generación de más conocimiento objetivo en forma de predicciones concretas, cuantitativas y comprobables referidas a hechos observables pasados, presentes y futuros. Con frecuencia esas predicciones pueden formularse mediante razonamientos y estructurarse como reglas o leyes universales, que dan cuenta del comportamiento de un sistema y predicen cómo actuará dicho sistema en determinadas circunstancias.

Fuente: Wikipedia. Creo que me estoy volviendo un copypaster…

Por lo tanto, como vemos la ciencia no es mala. Usando el método científico podemos tanto encontrar solución a algunas enfermedades como calcular la trayectoria de un proyectil. Como muchas otras cosas, la ciencia no es buena o mala, pero se puede usar para hacer tanto para hacer descubrimientos que beneficien a la humanidad (penicilina, la bombilla, medicina, medios de transporte…), como para encontrar formas más rápidas para terminar con el prójimo (ametralladoras, bombas, armamento en general). Como ya he dicho, no depende de la ciencia, que es sólo un concepto, sino de la intención de las personas, y el objetivo que éstas busquen.

Aquí es donde retomo el hilo de mi pequeña narración autobiográfica.

Poco a poco me di cuenta de que, a medida que pasaban los años, sucedía algo que no encajaba. Mientras que la ciencia, basada en evidencias y en el razonamiento lógico, cada vez avanzaba con más velocidad, dando a la gente de a pie nuevos coches, nuevos tratamientos, nuevos ordenadores y nuevos móviles, cada vez se publicaban más libros de temática paranormal, religiosa o New Age.

En ese momento ya había asimilado la religión como otra forma de creencia en fenómenos paranormales, ya que precisamente es lo que es, la creencia en un ser superior, incorpóreo y del que no se puede obtener pruebas de su existencia.


Equiparar dioses y seres paranormales no es un error, ya que están en el mismo plano.

Entonces me informé, busqué y encontré algunas cosas preocupantes. Sin ir más lejos, un cuarto de la población europea no se declara religiosa, y sólo un 5% se define como plenamente ateo. Este dato en sí no es preocupante, pero lo que sí lo es es que en muchísimas escuelas norteamericanas e inglesas (para nombrar dos países), se enseña evolucionismo y creacionismo en las mismas clases, con los mismos libros de texto, equiparando una teoría con un mito. En teoría así el alumno elige, pero con la enorme mayoría católica de ambos países, no es muy difícil pensar en los resultados.

Llegados a este punto, bastantes lectores (supongo que muchos) se preguntaran qué tiene de malo creer en una religión, sea la que sea. Creo que puedo resumirlo en unos pocos puntos.

1. Aceptar a un Dios como creador absoluto nos impide aceptar que la Tierra, como el resto del universo, tienen una edad de billones de años y que su creación fue de origen cósmico, con todo lo que deriva de ello. De la misma forma, el hecho de aceptar el creacionismo como válido nos obliga a dejar de lado la teoría de la evolución (de la que hay literalmente toneladas de pruebas), y, otra vez, todo lo que de ella se deriva.

Es precisamente la teoría de la evolución la que nos puede mostrar de dónde venimos y a dónde vamos, aunque nos queden incógnitas. El aceptar a un Dios como creador absoluto nos exime de pensar en ello, ya que entonces aceptamos que fuimos creados por Él y toda su creación existe por su voluntad.

Esto, aunque parezca una tontería para algunos, a muchos les cierra las puertas a investigar sobre este mundo, adentrándose en uno de fantasía.

2. Abandonar la lógica es abandonar el espíritu del hombre. No en el sentido literal, evidentemente, pero la naturaleza humana se basa en gran parte en preguntarse el por qué de las cosas, para comprender el mundo que nos rodea y a nosotros mismos. De aquí nació el método científico, para poder encontrar respuestas válidas con el máximo de fiabilidad. El hecho de aceptar una creencia irracional que responda a la mayoría de preguntas que nos hagamos con mitos y leyendas, es algo que, otra vez, nos aleja de la realidad y nos da unas respuestas que no son reales, por lo que volvemos a lo mismo: se deja la razón de lado y se acepta lo irracional como normal.

3. El hecho de poner a la misma altura la ciencia y una superstición no es que sea inadecuado, es peligroso. Es como intentar poner razón e irracionalidad al mismo nivel, dándoles la misma credibilidad y confianza.

El mundo no está pasando por una de sus mejores épocas, y en las décadas siguientes no creo que la tendencia vaya a disminuir. Hoy en día, el mundo puede vivir inmerso en la religión, creyendo que no es tan importante esta vida y este mundo como el paraíso y la vida después de la muerte. O el mundo puede enfrentarse a la realidad, afrontar los problemas e intentar superarlos, porque la única vida es esta, y es corta.

Lo que quiero dar a entender es que aunque no esté en juego el destino del mundo, la religión tiene que separarse completamente de la ciencia. Hoy en día podemos vivir sin religión, pero no sin ciencia. En cierta forma estamos volviendo al medievo, con sus supersticiones y creencias, pero con teléfonos móviles y armas nucleares.

Llegado este momento, creo que el lector tendrá clara las razones de mi postura.

De aquí creo que puedo sacar unas conclusiones personales:

Hoy en día creer en un dios no es necesario y, más aún, es algo que atenta directamente contra la lógica y la razón, fundamentales para obtener conclusiones válidas.

No es permisible que una creencia basada en supersticiones y mitos pase por delante de la ciencia y la razón.

Sería realmente muy conveniente no dar a los niños ningún tipo de educación religiosa en las escuelas, ya que puede llevarles a confundir un mito con la realidad.

Tiene que retirarse la absurda idea de que ciencia y religión pueden convivir, ya que son polos opuestos, y no precisamente de los que se atraen.

No es conveniente tratar a la religión como algo más que un mito, ya que esto puede generar la falsa imagen de que es algo más que justamente eso, un mito.

Aquí acaba este pequeño artículo sobre el ateísmo. Quiero dejar claro que esta es mi visión y experiencia personal con el ateísmo, y que una opinión no puede ser tomada como regla, sino sólo como referencia. Cuando tenga algo de tiempo explicaré en profundidad las causas y razonamientos que me llevan al ateísmo.

Post Scriptum: con este artículo no pretendo ofender a nadie, es triste que tenga que escribir esto pero ya sé lo que suele pasar. No tengo nada personalmente en contra de los seguidores de cualquier religión, de hecho tengo amigos religiosos. Pero estoy rotundamente en contra de quienes quieren imponer sus creencias a los demás, y con más razón si son irracionales.


192 Responses to El creacionismo hace llorar a mi mono

  1. Magufo dice:

    Ohh, no habia visto la actualización..mmm es un poco tarde y estoy algo somnoliento, no se si darle un ojo ahora un poco por encima y mañana volverlo a leer detenidamente. Un saludo.

    • alnarix dice:


      Creo aun estando abierto a otras opiniones,
      que me puedan demostrar que estoy equivocado.

      Que el Ateismo es un estado mediante el cual
      el/la individuo/a no reconoce como le han tra-
      tado de inculcar la existencia de un estado
      superior por el cual puede solicitar,recurrir
      a “Algo”.
      Puede o no saber,pero no acepta lo no aceptable.

      Puesto que esto puede tener base educacional
      y en ciertos aspectos y epocas el unico fin
      que ha perseguido es el dominio de las masas,,.

      Ello no lo veo como tal,es mas la falta
      llamole yo -pecado- es el privamiento
      autoimpuesto bien o reforzado tambien
      por el entorno de la no experimentacion de la
      propia existencia y la negacion del verdadero
      potencial interno inherente en cada ser.

      Hay alternativas al consumo de drogas,que no
      conociendo su verdadero fin inducen-por des-
      control- a estados psicoticos,existe el control
      de la respiracion en el yoga,yoga es union,no
      una asana -postura-

      Ignorancia entonces pues,para mi podria derivar
      ese ateismo al cual creo que se refiere.

      Jesus el Maestro,permanecio en su estado natural,
      legitimo.El Cristico,enseñando a la humanidad a
      vivir como el no renunciando nunca a su herencia

      Cristico,Budico,Atmico son Estados,no seres que
      han encarnado en un determinado intervalo de
      tiempo.Estados Mentales.

      Sin ofender,si quieres trabajar y que no te falte
      meteet a cura,enterrador o,o,o, politico.

      Ese pseudoateismo significa evasion,,,¿del

      2 y 2 no son 4,son dos y dos.

      Un cordial saludo.

      Todo es Mente.¿Quien y cuando se reconoce que
      alguien dijo eso?.

      • alnarix dice:

        Al gran maestro cuando le preguntaron
        y me refiero al calificativo de grande
        porque en ese avatar incluyo a los,,,

        + o – (tampoco estaba alli):”Maestro otros
        hay haciendo iguales cosas que tu,debemos
        seguirles”.A lo que el Venerable contesto,,.

        +2000 años y aun se jactan con el paseandolo
        crucificado ¿seria blanco como la leche,
        naceria en lugar de un pesebre en una cueva,
        llevaba barba,,,,,,?esas y otras.

        Ciertamente,en verdad,en verdad os digo
        que en el estado del Vaticano, muchos mendigos dejan estar.
        Cristiano es vivir en tal estado y solo
        hay uno,la verdad y la verdad es,,,,,,,

        PARAFERNALIA,Guerras y Pedofilia han causado
        ¿Puede alguien descender del cielo y decirme
        que estoy equivocado?.

        Anticristo es un ESTADO,anterior al
        Cristico o sea como suponemos al verdadero.
        Cree y reforzaras obsoletas

        Un Saludo Cordial.

    • alnarix dice:


      Digo yo,,que,,,¿debera de existir la evolucion,
      pues continuamente todo muta o sea debe de
      adaptarse a su entorno que lo circunda y a
      vez circunda el?.

      Reciba un Saludo.

  2. Mulder dice:

    Yo entiendo perfectamente tu punto de vista, es muy semejante al mío, pero un creyente “fuerte” no entenderá nunca ni tus decisiones ni tu punto de vista, es como “ciscar con una muerta”, por muy bien que se lo hagas, nunca te dará un abrazo.

  3. sbas dice:

    Chicos !!!!

    Desde mi posición de ateío agnóstico, pasados 16 años en escuelas jesuitas, le doy la razón en gran parte a AF.
    No obstante… Chicos !!!!… Chicos !!!!
    Como, otras veces, os he recriminado: as formas, vuestras formas.
    / Magufo… tu fanatismo desluce tus entendederas comportándote como el perro faldero que solo sabe aplaudir y admirar al “jefe”.

    / MLDR… tu calidad personal queda perfectamente aclarada con tus apostillas irrespetuosas casi siempre fuera de lugar, de tono, burdas e insultantes.
    _¿Tan mal te ha tratado la vida?
    _¿Qué tiene de gracioso tu desgraciado comentario sobre la muerta?
    Alguien así no merece ningún respeto de nuestra sociedad. Si pretendes respeto compórtate como merecedor de ello. Tu amargura y resentimientos esta claramente representados en tu avatar; si es tu fotografía, si no has sido muy explicito al escogerla.

  4. sbas dice:

    corrijodonde dice explicito debia poner : acertado

  5. Mulder dice:

    Rusia ordena el fin de las operaciones militares en Georgia

    El presidente ruso, Dimitri Medvédev, ha ordenado que se ponga fin a la operación militar en Georgia, según ha informado el Kremlin. “Sobre la base de su informe, he tomado la decisión de poner fin a la operación para forzar a las autoridades georgianas a la paz”, señaló Medvédev al ministro de Defensa ruso. Mientras tanto, la reunión de la OTAN con Rusia no se celebrará por falta de preparación.

    El presidente ruso también advirtió que Rusia no dudará en intervenir de nuevo si vuelven a aparecer nuevos “focos de resistencia” o nuevas “ambiciones agresivas” por parte de Tiblisi.

    “La operación alcanzó su objetivo, se logró restablecer la seguridad de la fuerza de raz (rusa) y de la población, el agresor se llevó el castigo y sufrió pérdidas sustanciales”, señaló Medvedev en el encuentro con el ministro de Defensa y el jefe del Estado Mayor General de las Fuerzas Armadas.


  6. airf0il dice:

    Mejor que haya terminado de una vez esta locura. Lo peor es que ahora algunos conspiranoicos estarán tristes porque no se cumplirán sus pronósticos.

    Y supongo que no volverá a aparecer por aquí RusoFB…o me equivoco?

  7. GAC dice:



    La Evolución Es una FARSA..


    Partimos de ahí para continuar..



    Estamos deacuerdo porque todos conocemos lo que significa ser ateo.. (Que aunque digais que lo he dicho.. no es sinónimo de ser malo.. el demonio.. el malígno o de ser la mismísima bestia).. no..

    Solo es sinónimo de estar equivocado .. nada mas. (Es mi opinión.. si quereis ser ateos lo respeto.. no me rajo las vestiduras por ello)..

    Ateismo fuerte o ¿positivo?..

    JAJAJA.. perdon.. es que me ha hecho gracia lo de las posibilidades gratuitas.. Quizá prefirais las posibilidades “de pago”.

    Osea segun entiendo yo por mucha prueba que os den.. que anda que no os las he dado ya aquí.. y ya ni decir razonamientos lógicos que me he hartado de ponerlos.. JAMAS.. será suficiente para vosotros.. .para aceptar la realidad de la existencia de Dios.

    En cambio a la hora de especular con aberraciones científicas de gran ingenuidad y basándose únicamente en suposiciones (a la luz de la evidencia arqueológica y científica actual).. como LA EVOLUCIÓN.. todos pensais que es una gran prueba.. y que debe ser considerada como CIENCIA..

    Me dan ganas de llorar.. porque veo un doble rasero terrible a la hora de generaros un pensamiento.. Sigo.

    Ateismo debil:

    Creo que todo el ateismo es debil.. porque parece mas el haber estado tan desilusionado y despechado de la idea de Dios por la maldad en religiosos o en el hombre.. De la vida misma.. y de las injusticias de esta.. que llegais a esa conclusión.. Mas por despecho o desamor que por convicción propia.

    Es como una venganza contra Dios.. como me mandas a este mundo tan injusto y bárbaro yo como pataleta.. decido no creer en tí.

    Me esconden la piruleta y me enfado y le doy una patada a la mesa.. aunque con ello me haga mas daño.

    No pretendo ofender a los ateos, ojo.. creo que si se dejan guiar por su conciencia (el altavoz de Dios en nuestra cabeza) podrán hacer cosas buenas con su vida y claro que sí.. ser “salvados” o tener contento a Dios.. ya que despues de la muerte.. nadie sabe seguro lo que hay.. Yo SEGURO estoy de que hay algo.. pero de ahi ya .. ir mas allá afirmando cosas me parece faltar a la verdad.


    España es un pais mayoritariamente creyente y católico.

    No recordais aquello de la España católica, apostólica y romana?.

    Ahora es un “estado laico”.. pues vale…

    Solo un dato.. ahora que españa esta abandonando su concepto de sociedad basado en la familia y en las tradiciones.. en la fé (porque no decirlo).. tenemos la peste del capitalismo y todas sus plagas haciendo estragos en nuestro orden social.. Volviendo locas a las mujeres con ansias de venganza infinitas contra lo que ellas llaman machismo … volviendo locos a los hombres que ya no saben el papel que tienen.. Los hijos hacen lo que les da la gana.. consumen drogas y solo tienen como referente los videojuegos y la televisión.. Y en general estamos viviendo una destrucción de la identidad como pais mas grave de toda su historia.

    Surgen nacionalismos por todas partes.. nos vemos invadidos por otras culturas y religiones.. que SÍ estan unidas..

    Etc etc.. Es eso casualidad o es todo producto de haberle dado la espalda a la sana religión y a sus sanas enseñanzas..

    En fin lo dejo como pregunta abierta.

    Tenemos.. niños sin padre.. educados por el estado, gente loca sin valores enferma por el consumismo, drogas y espectáculos, maquinaria de distracción funcionando a todo trapo para tapar las cada vez mayores miserias.. Una sociedad sin rumbo, sin valores mas allá del egoismo y la vida a corto plazo..

    Lo vamos a pagar caro todos.. y pronto…


    La ciencia no es mala pero si quieres meter a todos los cristianos en el mismo saco y pensar que todos estamos obligados por nuestra fé a ser contrarios a esta.. Piensa lo que quieras. Yo tambien puedo pensar que si camino hasta la pared la puedo atravesar.. pero si lo hago.. me daré de morros contra ella.. que es justo lo que te pasa a tí con algunas de las afirmaciones peregrinas que luego resultan ser falsas pero que vives feliz creyéndotelas.


    Recuerda que este mundo material es solo un plano de existencia, existen otros..

    Dios no es de este mundo.. y el alma que ahora tenemos encarcelada en el cuerpo.. no es de este mundo.. es inmortal.

    Lo entenderás cuando mueras.. espero que no sea demasiado tarde para tí,.. y puedas hacer algo por tu salud y vida espiritual antes en vida.


    1. Aceptar a un Dios como creador absoluto nos impide aceptar que la Tierra, como el resto del universo, tienen una edad de billones de años y que su creación fue de origen cósmico, con todo lo que deriva de ello. De la misma forma, el hecho de aceptar el creacionismo como válido nos obliga a dejar de lado la teoría de la evolución (de la que hay literalmente toneladas de pruebas), y, otra vez, todo lo que de ella se deriva.







    “Una de las grandes tragedias de nuestro tiempo es esta impresión que ha sido creada de que la ciencia y la religión tienen que estar en guerra ” escribe Francis Collins, en la actualidad director del Instituto Estadounidense de Investigación del Genoma Humano, en su libro “El lenguaje de Dios”, que será publicado en septiembre. Collins confiesa que el descubrimiento del genoma humano le permitió “vislumbrar el trabajo de Dios”. Reivindica que hay bases racionales para un Creador y que los descubrimientos científicos llevan al hombre “más cerca de Dios”.


    h ttp://blogs.periodistadigital.com/infordeus.php/2006/08/29/el_descubridor_del_genoma_humano_cree_en

    h ttp://www.geocities.com/reflexiones_biblicas/lafalsateoriadelaevolucion.htm


    Es precisamente la teoría de la evolución la que nos puede mostrar de dónde venimos y a dónde vamos, aunque nos queden incógnitas. El aceptar a un Dios como creador absoluto nos exime de pensar en ello, ya que entonces aceptamos que fuimos creados por Él y toda su creación existe por su voluntad.




    Abandonar la lógica es abandonar el espíritu del hombre. …

    DESDE CUANDO ESTA REÑIDO EL SER CIENTÍFICO Y LÓGICO AL 100% Y CREER EN DIOS?.. ME RECUERDAS A GOEBBELS .. (Una mentira repetida adecuadamente 1000 veces se convierte en verdad).. para tí .. ¿no?…


    3. El hecho de poner a la misma altura la ciencia y una superstición no es que sea inadecuado, es peligroso.



    Lo que quiero dar a entender es que aunque no esté en juego el destino del mundo, la religión tiene que separarse completamente de la ciencia. Hoy en día podemos vivir sin religión, pero no sin ciencia. En cierta forma estamos volviendo al medievo, con sus supersticiones y creencias, pero con teléfonos móviles y armas nucleares.




    Hoy en día creer en un dios no es necesario y, más aún, es algo que atenta directamente contra la lógica y la razón, fundamentales para obtener conclusiones válidas.



    h ttp://blogs.periodistadigital.com/infordeus.php/2006/08/29/el_descubridor_del_genoma_humano_cree_en


    Francis Collins fue ateo hasta los 27 años, cuando como joven médico le llamó la atención la fuerza de sus pacientes más delicados. “Tenían terribles enfermedades de las que con toda probabilidad no iban a escapar, y todavía, en lugar de quejarse a Dios, parecían apoyarse en su fe como una fuente de consuelo. Fue interesante, extraño e inquietante”. Luego leyó “Mere Christianity” (Mero cristianismo) de C. S. Lewis, que lo ayudó a convertirse. Collins explica que el argumento de Lewis, que Dios es una posibilidad racional, era algo “que no estaba preparado para oír. Estaba muy feliz con la idea de que Dios no existía y de que no tenía interés en mí. Pero al mismo tiempo, no podía alejarme”.


    No es permisible que una creencia basada en supersticiones y mitos pase por delante de la ciencia y la razón.



    tu pones:

    Sería realmente muy conveniente no dar a los niños ningún tipo de educación religiosa en las escuelas, ya que puede llevarles a confundir un mito con la realidad.





    Tiene que retirarse la absurda idea de que ciencia y religión pueden convivir, ya que son polos opuestos, y no precisamente de los que se atraen.




    No es conveniente tratar a la religión como algo más que un mito, ya que esto puede generar la falsa imagen de que es algo más que justamente eso, un mito.






  8. GAC dice:


    Mejor que haya terminado de una vez esta locura. Lo peor es que ahora algunos conspiranoicos estarán tristes porque no se cumplirán sus pronósticos.

    Y supongo que no volverá a aparecer por aquí RusoFB…o me equivoco?





  9. Magufo dice:

    Mira, cada uno puede tener sus creencias irracionales, tu crees en el Dios cristiano, otros creen en el gran Ju-ju del fonde del mar y otros en el gran Ju-ju de la montaña, yo personalmente creo en el unicornio rosa invisible, hasta ahi vale.

    Pero lo de la evolución? JAJA y mas JA. He leido tus pruebas de que la evolucion es imposible y no es mas que la misma cancioncilla de siempre, viejuno viejuno, casi que me da un deja vu de lo mascado que estan esos argumenos. Por mi parte no voy a contestar a ninguno mas de tus comentarios, te dejo ahi solo escribiendo hasta que te aburras a ti mismo.

  10. airf0il dice:

    GAC, acabas de hacer llorar a mi mono.

    Hay toneladas de pruebas sobre la evolución y la edad geológica de le Tierra, y mi mono lo sabe.

  11. airf0il dice:

    Por cierto, no te preocupes, no ofendes a los ateos. Sólo nos llamas seres errados, equivocados, mentirosos y cerrados de mente, pero no nos sentimos ofendidos.

    Seguiría contestándote, pero sé que esto se va a alargar innecesariamente. Te lo diré en un par de frases.

    Hoy en día, hay tantas pruebas de la existencia de dioses como de la existencia de gamusinos. Exacto, ninguna. Y tampoco nos lleva a su existencia ningún razonamiento lógico.

  12. sbas dice:

    GAC. en algunos puntos he participado de su opinión. La cual he suscrito en mayor o menor medida. En este caso, no puedo ni le daré el más mínimo apoyo. Dioses, dios, disosillos varios y, en especial, sus respectivos manuales de I+D. Lo digo; con todo el respeto a aquellas personas creyentes, con mi irrespeto a cualquier religión (esencialmente a SUS HISTRIONES DE MARQUETING), debo formularle una pregunta.
    _¿Conocidos, autentificados, vistos y leídos los manuscritos de Qumram, que la Iglesia católica como nos tiene acostumbrados, tuvo a bien intentar destruir y ocultar durante anos: CÓMO DEBEMOS INTERPRETAR EL CRISTANISMO y sus textos, copias/adaptaciones de los anteriores pero con idénticos autores?
    No me diga que la interpretación “Constantiniana” católica, apostolica, R. y por la FE, porque exactamente es la respuesta de un islamista, hinduista o cualquier otro creyente de las muchas religiones habidas.

  13. sbas dice:

    Personalmente para terminar con la cuestión puesto que esa tesis y se debatirá por otros 2000 anos.
    Le veo desde el punto de vista cristiano, puesto que desde ahí debate -en otros credos esta óptica no cabe-, dos posibilidades.
    /Que ese dios sea infinitamente bueno y haga lo que yo haga será incapaz de mandarme al infierno y entonces la parafernalia de la religión y seguir sus mandamientos lo único que conseguirán es adocenarme y amargar ni existencia.
    /O que sea infinitamente malísimo con lo cual poco importará que este flagelándome y viviendo según las reglas de su religión pues, si le apetece, me mandará al carajo.

  14. Magufo dice:

    Que bueno este video

    Y este otro me recuerda a alguien conocido de este blog, será esta su infancia?


  15. GAC dice:

    En lugar de poner largos post me dedicaré a desmontar la teoría de la evolución con pruebas que es lo que os gusta aquí, o eso decís.

    Tambien esta mascado esto?..




    ¿Qué punto de vista tiene el apoyo del registro fósil?

    Darwin reconoció: “Si numerosas especies […] en realidad han comenzado su existencia de una vez, ese hecho sería mortal para la teoría de la evolución” (The Origin of Species [El origen de las especies], Nueva York, 1902, Parte II, pág. 83). ¿Indica la prueba existente que “numerosas especies” llegaran a la existencia al mismo tiempo, o señala a desarrollo gradual, como afirma la enseñanza de la evolución?

    Porter Kier, científico de la Institución Smithsoniana, dice: “En museos de todo el mundo hay cien millones de fósiles, todos catalogados e identificados” (revista New Scientist, 15 de enero de 1981, pág. 129). A Guide to Earth History (Guía a la historia de la Tierra) añade: “Con la ayuda de los fósiles los paleontólogos pueden darnos ahora un cuadro excelente de la vida de las edades pasadas” (Nueva York, 1956, Richard Carrington, edición Mentor, pág. 48).

    ¿Qué hay de las ilustraciones en los libros sobre los hombres monos?

    “La vasta mayoría de las concepciones artísticas se fundan más en la imaginación que en la prueba. […] Los artistas tienen que crear algo que se encuentre entre un antropoide y un ser humano; mientras más antiguo se diga que es el espécimen, más parecido a mono lo hacen.” (Science Digest, abril de 1981, pág. 41.)

    “Tal como lentamente estamos aprendiendo que los hombres primitivos no son necesariamente salvajes, así tenemos que aprender a darnos cuenta de que los hombres primitivos del período Glacial no eran ni bestias brutas ni semiantropoides ni cretinos. De ahí la inefable estupidez de todos los intentos por reconstruir al hombre de Neandertal o hasta al hombre de Pekín.” (Man, God and Magic [El hombre, Dios y la magia], Nueva York, 1961, Ivar Lissner, pág. 304.)

    ¿Pudiera ser que el proceso evolutivo tuviera lugar como resultado de mutaciones, es decir, cambios drásticos que tuvieran lugar de súbito en los genes?

    Science Digest declara: “Los revisionistas de la evolución creen que las mutaciones en genes regulativos clave pueden ser precisamente los ‘martillos neumáticos’ genéticos que su teoría de saltos significativos exige”. Sin embargo, esa revista también cita la siguiente declaración del zoólogo británico Colin Patterson: “El razonamiento superficial anda sin restricción. No sabemos nada acerca de estos genes maestros regulativos” (febrero de 1982, pág. 92). En otras palabras, no hay ninguna prueba en apoyo de la teoría.

    The Encyclopedia Americana reconoce lo siguiente: “El hecho de que la mayoría de las mutaciones son dañinas al organismo parece difícil de conciliar con el punto de vista de que la mutación sea la fuente de materia prima para la evolución. Ciertamente los mutantes que se ilustran en los libros de texto de biología son una colección de fenómenos y monstruosidades, y la mutación parece ser un proceso destructivo, más bien que constructivo” (1977, tomo 10, pág. 742).

    “Destruiré la sabiduría de los sabios (científicos), y desecharé la inteligencia de los inteligentes. ¿Dónde está el inteligente? ¿Dónde está el científico? ¿No ha quedado enloquecida la sabiduría de ellos? 1 Corintios 1:19-21(Nueva Versión Internacional)



    h ttp://www.creacionismo.net/inicio/index.php?option=com_content&view=article&id=48&Itemid=64

    h ttp://www.creacionismo.net/inicio/index.php?option=com_content&view=article&id=1:que-es-el-creacionismo&catid=35:general&Itemid=63

    h ttp://www.creacionismo.net/inicio/index.php?view=article&catid=35%3Ageneral&id=14%3Ai-es-la-evolucion-un-hecho-demostrado-cientificamente-&option=com_content&Itemid=63

    h ttp://www.creacionismo.net/inicio/index.php?view=article&catid=35%3Ageneral&id=49%3Ai-es-verdad-que-la-evolucion-ha-alcanzado-un-amplio-consenso-cientifico-&option=com_content&Itemid=63

    h ttp://www.creacionismo.net/inicio/index.php?view=article&catid=36%3Ael-origen-de-la-vida&id=50%3Abiogenesis-la-ciencia-refuta-el-darwinismo&option=com_content&Itemid=27

  16. GAC dice:


    Te entiendo perfectamente y respeto todas vuestras opiniones.. Mi fé se basa en el hecho para mí comprobado de los beneficios que ha tenido mi vida la nueva forma que he conseguido verla.

    No espero ni obro así… para ganarme un Cielo o por miedo al infierno.. me parece que el cielo o el infierno ya se viven en el presente dependiendo de como elijamos vivir esta vida. No hay que tener tanto miedo porque si tenemos miedo estamos ya predispuestos a dejarnos pisar por otros.. eso sí es verdad.

    De lo que tengo seguridad es de la existencia de Dios y de que esta vida es temporal.

    Podría pensar en reencarnación como dice Ian Stevenson o en todas las religiones y creencias como verdaderas pero jamas podría negar que lo que ahora siento al estar digamoslo así sintiendo esta felicidad interior en mi conciencia proviene nada mas de que me estoy “autoengañando”.

    La existencia de la conciencia y de muchas verdades universales hace imprescindible creer en Dios.. Negar que esta vida solo sea parte de algo mucho mas grande y que con la muerte no se hace mas que cambiar de “cuerpo” o “plano”.. me parece tan absurdo y carente de lógica que no entiendo a la gente que lo plantea por el solo hecho de no poder demostrarlo.

    Es que acaso podemos demostrar la existencia del sol si estamos en una cueva?.. No, no podemos pero sabemos que esta ahí por los indicios .. que esta muestra..

    Me parece muy triste vivir esta vida tan falta de lógica creyendose científico si se piensa que con la muerte todo acaba.. porque ya de por sí .. es tan absurdo sacrificarse y luchar por tantas cosas en la vida para al final acabar en nada.. que pierde todo sentido.


    Otro día hablaré de las experiencias cercanas a la muerte o de lo que opinan la mayoría de médicos con lo que han visto a lo largo de sus carreras sobre el cuerpo humano… y sobre el alma.

  17. Magufo dice:

    Vaya cosas, hasta tus propios textos apoyan la evolucion.

    Hay varias cosas de las que no estas informado. No distingues el hecho de la evolucion y sus mecanismos explicativos, para ti es lo mismo evolucion que darwinismo y esto es otra MENTIRA mas.

    Evolucion a saltos, pues claro, a saltos y gradual, hay ejemplos de las dos. ¿donde esta la novedad?

    Por otro lado una cita de la enciclopedia americana de 1977 es un poco desfasada no crees? quiza deberias actualizar tu bibliografia unos 20 años, no crees?

    Con la de textos que hay hablando de mutaciones y has tenido que coger uno de 1977 cuando la biologia molecular aun estaba en su infancia.

    Primero informate un poquito de lo que es la evolucion, que es el hecho y cuales son los mecanismos aceptados. Quizas luego estes a la altura para poder hablar sobre ella.

  18. airf0il dice:

    GAC, te moleste o no, la evolución es un hecho. Y de esto hay muchísimas pruebas, tú de tu “teoría” no tienes ni una. Y creer que todo fue creado así, pim pam, en unos días, es por lo menos infantil.

  19. GAC dice:


    Vaya cosas, hasta tus propios textos apoyan la evolución.


    ESTOY INFORMADO, si distingo.. y para no extenderme mucho te pegaré un artículo en el que te demuestro una vez mas.. que el concepto de evolución como tal es una falacia.. manipules o retuerzas mis palabras para que segun tú este mintiendo o no.

    La enciclopedia esa esta desfasada?.. Y tambien está desfasado lo que dice F.Crick, premio Nobel de biología por el hallazgo del ADN, “un hombre honesto tendría que aceptar que el origen de la vida se debe a un milagro. ” osea a Dios.


    Tengo que estar a la altura para poder hablar con vosotros?… JAJJAAJ.. pero si de cada 10 cosas que decís 8 son mentira o tienen parte de mentira.. me parece que debería ser al reves.

    h ttp://ecrax.blogspot.com/2007/12/descubriendo-las-maravillas-de-la.html

    Pero se trataría de algo más que de antropomorfismo, porque nosotros no hemos programado los genes ni los controlamos. Por tanto, parece que esa programación sólo puede atribuirse a alguien que esté por encima de nosotros y de la naturaleza; más aún, a alguien que sea el autor de la naturaleza, o sea, a Dios.

    Nuevos avances en la Biología molecular: genes inteligentes
    Mariano Artigas
    Publicado en Aceprensa, 161/91 (4 diciembre 1991)

    h ttp://www.unav.es/cryf/nuevosavancesenbiologiamolecular.html

    Querias biología molecular.. pues ahi tienes..


    Si lees con detenimiento el último artículo que pongo verás que persiste se mire a donde se mire la huella de Dios.

    Dice el necio en su corazón:
    No hay Dios.
    Se han corrompido, hacen obras abominables;
    No hay quien haga el bien.

    Pronto vendrá Jesucristo y restablecerá todas las cosas.. el acabará con los que acaban con la tierra.

    Haya suerte amigos ateos.. se os caerán tan rápido vuestras creencias que no os quedará mas remedio que arrodillaros ante el creador del universo.

    Saludos. Podeis blasfemar por decir esto todo lo que querais pero no puedo arrepentirme por ello porque es la verdad.. lo vereis tranquilos..

    Inteligencia inconsciente.

    Lo notable es que la naturaleza viene utilizando medios de información,codificación, interpretación ytransmisión enormemente sutiles mucho antes que nosotros los hayamos descubierto y, con frecuencia, de un modo más eficaz. Los avances de la biología molecular así lo manifiestan.

    Es difícil que esto no produzca asombro. Desde luego, la reflexión acerca de este hecho conduce a razonamientos que, en ocasiones, no son sencillos. Pero una cosa parece clara, y es la siguiente. Si hoy día vivieran autores antiguos, como Santo Tomás de Aquino, que han visto en la naturaleza una especie de inteligencia inconsciente que necesariamente remite a una Causa primera inteligente (un Dios creador y ordenador ), contemplarían con enorme satisfacción los conocimientos actuales acerca de la biología molecular.

  20. GAC dice:

    Por cierto no pretendo resultar ofensivo.. lo digo una vez mas. Pero es que a todas luces.. me parece al menos a mi (ya para ser humilde) que estais negando la evidencia, osea, estais mintiendo.

    Es mi opinión.. no os ofendais que no vengo aquí a insultar sino a mostrar pruebas de lo que digo.

  21. GAC dice:

    No pretendo resultar ofensivo solo mostraros las pruebas que lo que digo es verdad.

  22. Heli dice:


    Es una tontería lo que dices. Es la primera tontería de una serie larga de idioteces, pero ya empiezas mal mezclando la evolución con las explicaciones sobre el origen de la vida. La Teoría Sintética de la Evolución funciona muy bien y aparte de la ciencia que se pueda estar haciendo sobre el origen de la vida (que esta ciencia pueda echar mano del neodarwinismo es otra cuestión), ya que la Síntesis Evolutiva Moderna se limita a describir y explicar los cambios en los seres vivos, y lo hace bien, aportando millones de pruebas científicas, pero no se dedica a el génesis, ni necesita de una explicación sobre los inicios de la vida. Es penoso que los jóvenes andeis tan impacientes por decir babosadas sin formaros mínimamente sobre el tema que queréis tratar, tan lamentable como el hecho de que estáis perdiendo la netiqueta (no es de buena educación escribir todo con mayúsculas).

    Por cierto buen blog y felicitaciones por el cabal ateísmo del autor 🙂

  23. GAC dice:


    Si hubieses leido en el hilo anterior verás que escribo con mayúsculas para diferenciar cuando contesto a otros post.

    Pero, tienes razón, es de mala educación, no lo haré mas, separaré con guiones lo que yo digo de lo que cojo de otros contertulios para contestar.

    ¿Digo tonterías?, demuéstramelo.. hablar es muy facil.. yo siempre procuro poner pruebas o textos que apoyen lo que digo y no solo venir a dar discursos..

    Internet esta lleno de charlatanes cuando se dice algo hay que demostrarlo.


    “GAC, te moleste o no, la evolución es un hecho. Y de esto hay muchísimas pruebas, tú de tu “teoría” no tienes ni una. Y creer que todo fue creado así, pim pam, en unos días, es por lo menos infantil.”

    Porfavor muestrame alguna de esas pruebas y la debatimos porque afirmar las cosas sin tener un mínimo de respaldo científico de lo que dices .. como tu mismo me decías cuando hablabamos de chemtrails .. es faltar a la verdad.

    He repetido dos post, lo siento es por problemas con la conexión que utilizo (que no es mia)…

    Espero a que me ilumineis con vuestros conocimientos a la prueba irrefutable de que la evolución es verdad y a la prueba de que la vida surgió “por casualidad” de materia muerta.. y de ahí mutó para convertirse en todas las especies que tenemos ahora.

    Me he hartado de poner pruebas de la existencia de Dios.. me podeis probar que no existe?..

    Hasta otra..

  24. Manuel Abeledo dice:

    GAC, sí, dices tonterías.

    No hay pruebas científicas de que la evolución no sea un hecho. Simplemente ocurre y eso es indiscutible. Un ejemplo demostrable a corto plazo son los patógenos resistentes a los antibióticos, si es que todavía crees que no hay fósiles suficientes para dibujar la evolución de muchas especies.

    Podrías argumentar que no hay fósiles para construir el árbol evolutivo de todas las especies, aunque yo te contestaría que tampoco hay teorías específicas que expliquen los fenómenos físicos en cada cuerpo celeste.

    También podrías decir que hay documentos que prueban la invalidez de la teoría de la evolución, así que permíteme que me adelante y te pida que me muestres aquellos que no tengan relación alguna con una organización religiosa. Sin ir más lejos creo que enlazas alguno de los panfletos del Discovery Institute, lo cual me parecería hasta insultante si pretendes hacerlos pasar por pruebas científicas.

    Supongo que te molestaría esto último y podrías acudir al casi tópico del diseño inteligente como hipótesis laica, con Michael Behe a la cabeza. De nuevo te encontrarías con el Discovery Institute y un rechazo frontal de la inmensa mayoría de la comunidad científica.

    De hecho, si no recuerdo mal, apenas hay 200 científicos de baja cualificación que están a favor del diseño inteligente en el mundo, y por si no fuera poco la mayoría no son biólogos. Da que pensar.

  25. airf0il dice:

    Gracias heli, pero es triste que hoy en día se tenga que felicitar a alguien por su ateísmo.

    GAC, no digas que no has venido a ofender. Deja la hipocresía en otro lado, que ya me has insultado a mí y a varios lectores abiertamente, además de acusarnos de mentirosos y necios. Y dices que no quieres ofender a nadie? Que no me chupo el dedo…

    Por cierto, si realmente quisieras pruebas de la evolución, sólo tenías que entrar en la Wikipedia. Copio y pego:

    Evidencias de la evolución

    Se le ha llamado así al conjunto de pruebas que los científico han reunido para demostrar que la evolución de la materia viva es un proceso que le es característico. Estas pruebas se han agrupado en las siguientes categorías:

    * Paleontológicas: son las evidencias que se derivan de los descubrimientos de los restos fósiles dejados por las especies que habitaron la tierra en otras eras geológicas. Cuanto más remota es una especie fósil, más diferente es de las especies actuales.

    * Anatómicas: al realizar un estudio comparativo de los órganos de los distintos seres vivos, se han encontrado semejanzas en su constitución que nos señalan el parentesco que existe entre las especies. Estas evidencias nos permiten clasificar a los órganos en:
    o Órganos homólogos, si tienen un mismo origen embrionario y evolutivo, pero con funciones distintas
    o Órganos análogos, si tienen un origen embrionario y evolutivo distinto pero que realizan la misma función.
    o Órganos vestigiales, que están reducidos y no tienen función aparente, pero que muestran claramente que derivan de órganos funcionales presentes en otras especies (como los huesos rudimentarios de las patas popsteriores presentes en algunas serpientes)

    * Embriológicas: son los estudios comparativos de las etapas embrionarias de distintas clases animales. Se ha encontrado que en las primeras de estas etapas del desarrollo, muchos organismos muestran características comunes que apuntan hacia la existencia de un patrón de desarrollo compartido entre ellas, que a su vez, demuestran la existencia de un antepasado común. El sorprendente hecho de que los embriones tempranos de mamíferos posean hendiduras branquiales que luego desaparecen demuestra que estamos lejanamente emparentados con los peces.

    * Bioquímicas: son estudios comparados de las proteínas y ácidos nucleicos que forman parte de diferentes seres vivos, comprobándose que dichas biomoléculas son muy semejantes entre algunas especies, lo que apunta a su origen común y que, por el contrario, conforme la distancia evolutiva se hace mayor, las semejanzas desaparecen gradualmente.

    * Biogeográficas: el estudio de las áreas de distribución de las especies muestra que cuanto más alejadas i/o aisladas están dos áreas geográficas, más diferentes son las especies que las pueblan, aunque ambas áreas tengan unas condiciones ecológicas similares (como el ártico y la antártida, o la región mediterránea y California).

    Supongo que ahora verás que hay pruebas de la teoría de la evolución (toneladas, como ya he dicho), y sigo sin ver ni un triste indicio de que crees en algo real. Como verás, hay un ligero desequilibrio…

  26. airf0il dice:

    Manuel, intentar que comprenda algo es como intentar pellizcar un cristal. Físicamente imposible…

  27. Heli dice:

    “¿Digo tonterías?, demuéstramelo..”

    Evolucione, y después lea sus comentarios, y entonces verá la de tonterías que dice. Ya me he dignado a explicarle una y usted sigue mezclando la evolución con el génesis. No hay caso, y eso que es facilisimo acceder a la información. Va enredando usted con textos de dudosa procedencia junto a críticas a la moralidad de los presentes y los típicos delirios sobre la inminente llegada de su dios. Si esas historias le animan disfrútelas pero la teoría de la evolución va a seguir existiendo y dando sus frutos al margen de sus creencias.

  28. Heli dice:

    “Gracias heli, pero es triste que hoy en día se tenga que felicitar a alguien por su ateísmo”.

    No es que me parezca que el ateísmo sea la gran cosa, me parece tan profundo como ser apitufista, pero entiendo que hasta eso tendría su importancia si a una gran parte de la sociedad le diera por adorar al Gran Pitufo. Y hay ateísmos y ateísmos, y el suyo esta muy bien argumentado 🙂

  29. Mulder dice:

    Aporto un ejemplo, la evolución de los Australosfénidos, creo que está bastante bien explicado, pero no puedo asegurar que un hombre de “fe” llegue a entenderlo, no obstante, aquí está, explicado y demostrado, no como los que predicen el fin del mundo tomándonos por tontos.

  30. Sencillo dice:


  31. airf0il dice:

    Y cómo surgió Dios?;)

  32. Sencillo dice:

    Eres tu el que tienes que responder a la pregunta 1) para evitar la explicación lógica de la existencia de Dios

  33. Sencillo dice:

    Sigo preguntándote : ¿Porque surgió el universo?, el porque no el como ni elcuando, el PORQUE

  34. airf0il dice:

    Voy a extenderme un poco en este tema, porque me interesa. Veamos.

    Planteado este hecho demostrado ya científicamente, osea mediante el método científico; entonces las preguntas que hago al ATEO, SON ESTAS:1) ¿PORQUÉ SURGIÓ EL UNIVERSO ? ( COSA QUE NO PUEDE HACER )”

    Cómo que no puede hacer? No hay respuestas para todo.Por qué existimos, cuál es nuestro papel en este mundo?


    Como no entiendo lo suficiente del tema, no opinaré.


    A ver, la cosa está en que muchos religiosos se preguntan cómo nuestro universo es tan perfecto, equilibrado y preciso. La respuesta es fácil:

    Un universo que no es equilibrado, que es caótico, no puede existir, así de sencillo. Y como no pueden existir universos caóticos, sólo podemos vivir en uno que no lo sea. No es tan difícil.


    El ateo no es que pueda hacerlo, esque lo hace.


    Puedo hacer dos cosas. Usar la razón, el método científico y los hechos contrastados para investigar e intentar llegar a la respuesta de una pregunta, o dejar de lado la razón, y creer ciegamente en lo que presuntamente dice un ser sobrenatural del que no podemos probar la existencia, y aceptar sus respuestas para esas preguntas.

    Y no acabo de entender por qué el universo necesita una razón para existir. Una piedra necesita una razón para existir? No. Sencillamente existe, no es como una persona, que necesita una motivación para hacer X acto.

  35. airf0il dice:

    Pero no me vas a contestar por qué existe dios, ni quién lo creó?

  36. GAC dice:

    Señores estan mintiendo, siguen con la teoría de la evolución como una realidad cuando es una teoría falsa.

    Para no ponerme a decirles porque estan equivocados de mis propias palabras ya que soy consciente del análisis terrible de todo lo que digo para poder criticar algun posible error que pueda cometer al decirlo, me limitaré a aportar mas y mas pruebas y a refutar las suyas.

    Manuel Abeledo dijo:

    “No hay pruebas científicas de que la evolución no sea un hecho.”

    En realidad los que defendeis esa teoría deberíais aportar pruebas y no esperar a que yo demuestre que es falso.. pero bueno aun así lo haré.

    Sí, con fósiles para empezar pero tranquilos tengo documentos para rato..

    h ttp://www.evolutiondeceit.com/espanol/conferencia.php

    h ttp://www.evolutiondeceit.com/espanol/10_paginacion.php

    h ttp://www.piedrasdeica.es/origenhomo.html


    h ttp://www.scribd.com/doc/3289926/Creacionismo-o-evolucion

    h ttp://www.newsgrupos.com/es-ciencia-misc/557313-es-cientifica-la-teoria-de-la-evolucion-los-evolucionistas-culpables-de-extrapolacion.html


    h ttp://www.harunyahya.org/other/evolucionismo/evoluc04.html

    Quizá os interese este artículo en el que se muestra como hay una necesidad de creer y de tomar la evolución como hecho .. cuando sigue siendo una teoría.. con muchas mentiras a sus espaldas.

    h ttp://www.apologeticspress.org/espanol/articulos/404

    La evidencia fósil para la evolución (humana o distinta) simplemente no existe. Los simios siempre han sido simios—y los humanos siempre han sido humanos. El hombre no evolucionó en millones de años de antepasados como-simios. En cambio, como Génesis 1:26,27 nos dice, la humanidad fue creada a la “imagen y semejanza de Dios” (cf. Hechos 17:28,29). El salmista, hablando de la creación de Dios del hombre, escribió: “Le has hecho poco menor que los ángeles, y lo coronaste de gloria y de honra” (8:5). El hombre no evolucionó de una criatura “sin imagen”, sino en cambio fue creado por Dios.

    h ttp://www.apologeticspress.org/espanol/articulos/403

    h ttp://www.apologeticspress.org/espanol/articulos/3611

    h ttp://www.apologeticspress.org/espanol/articulos/3528

    Ahi teneis muchos mas artículos:

    h ttp://www.apologeticspress.org/espanol/creacionvsevolucion/

    Interesante su lectura haber si caeis del burro:

    h ttp://ar.answers.yahoo.com/question/index?qid=20080206185236AAwGDf6

    h ttp://jolimu.wordpress.com/2008/01/24/el-adn-vs-darwin/


    “GAC, no digas que no has venido a ofender. Deja la hipocresía en otro lado, que ya me has insultado a mí y a varios lectores abiertamente, además de acusarnos de mentirosos y necios. Y dices que no quieres ofender a nadie? Que no me chupo el dedo…”

    Os he acusado de mentirosos porque habeis mentido y eso no es ser hipócrita. Por otro lado, ¿quien fue el que empezó insultando y el que ha faltado mas a la verdad?.

    Revisa otros hilos de tu blog en el pasado..

    Sois la prepotencia hecha persona nisiquiera te parece bien si te pido disculpas por alguna cosa que pude decir.. joder como si tú fueses un angelito ..

    Bueno para no ponernos a discutir jilipolleces te informo que te estoy refutando las mentiras con pruebas.

    Hasta ahora te he detectado ya las siguientes mentiras en este blog, DE LA VERDAD:





    3º No existen pruebas de la existencia de Dios.. Te he mostrado muchas pero tampoco las quieres considerar.

    Y alguna mas que ahora no me acuerdo.

    En fin como ves procuro aportar pruebas de lo que digo.. Si no he sido todo cordialidad es porque tampoco me lo habeis puesto muy facil y os habeis dedicado en muchas ocasiones a atacar y desprestigiar las críticas a vuestra verdad a la voz de MAGUFOS, ILUMINADOS, ETC.

    Mira los post pasados en el blog para ver quien miente y quien no………………………

    • barcoca dice:

      Para ustedes los que se dicen llamar ¨científcos¨ por ponerle un ejemplo ustedes aprueban lo historico y real que es La Bíblia que es la palabra de Dios y si están aprovando este libro, en él dice que existe Dios

  37. GAC dice:

    Airfoil dijo:

    “Puedo hacer dos cosas. Usar la razón, el método científico y los hechos contrastados para investigar e intentar llegar a la respuesta de una pregunta, o dejar de lado la razón, y creer ciegamente en lo que presuntamente dice un ser sobrenatural del que no podemos probar la existencia, y aceptar sus respuestas para esas preguntas.”

    Sigues con lo mismo.. y digo yo.. ¿No puedes utilizar como hacemos otros la razón, el método científico y los hechos contrastados para investigar y llegar a comprender el universo creado por Dios?…

    Ese ser sobrenatural no te esta obligando a que te fíes ciegamente de él, puedes investigar cuanto quieras como han hecho tantos en la historia y comprobarás que todas sus verdades también son las de la ciencia.


    “Y no acabo de entender por qué el universo necesita una razón para existir. Una piedra necesita una razón para existir? No. Sencillamente existe, no es como una persona, que necesita una motivación para hacer X acto.”

    Si quieres probar tus teorías necesitas una razón para que el universo exista como es. Sobre todo para demostrar el milagro de la vida y de todos los mecanismos perfectos sobre los que esta se sustenta.

    Como ya te he demostrado tus teorías ateas son falsas o se apoyan en datos falsos. El diseño inteligente del universo es algo incuestionable hasta que sea refutado completamente por la ciencia lo cual es ya prueba de un diseñador.. osea de Dios.

    Y desecharé la inteligencia de los inteligentes. ¿Dónde está el inteligente? ¿Dónde está el científico? ¿No ha quedado enloquecida la sabiduría de ellos? 1 Corintios 1:19-21

    El mensaje de la cruz es una locura para los que se pierden, pero para los que se salvan –para nosotros– es fuerza de Dios. 19 Porque está escrito: Destruiré la sabiduría de los sabios y rechazaré la ciencia de los inteligentes. 20 ¿Dónde está el sabio? ¿Dónde el hombre culto? ¿Dónde el razonador sutil de este mundo? ¿Acaso Dios no ha demostrado que la sabiduría del mundo es una necedad? 21 En efecto, ya que el mundo, con su sabiduría, no reconoció a Dios en las obras que manifiestan su sabiduría, Dios quiso salvar a los que creen por la locura de la predicación. 22 Mientras los judíos piden milagros y los griegos van en busca de sabiduría, 23 nosotros, en cambio, predicamos a un Cristo crucificado, escándalo para los judíos y locura para los paganos, 24 pero fuerza y sabiduría de Dios para los que han sido llamados, tanto judíos como griegos. 25 Porque la locura de Dios es más sabia que la sabiduría de los hombres, y la debilidad de Dios es más fuerte que la fortaleza de los hombres.

    No sigo que me acusarás de venir a rezar a tu blog. Espero impaciente que me expliques el porque no hay restos arqueológicos que confirmen la peregrina teoría de la evolución.

    Y no me digas que no se ha investigado suficiente porque es mentira.

  38. Sencillo dice:

    Airf0il dice:

    “Y no acabo de entender por qué el universo necesita una razón para existir.”
    Pues si no lo entiendes no puedes tampoco responder a la pregunta: ¿PORQUE SURGIO EL UNIVERSO?
    Yo estoy hablando con un ser inteligente,una persona, tu ¿o no?, no con una piedra.
    Sigues sin poderme responder a la pregunta 1) ni tu ni el método científico.

  39. Sencillo dice:

    airf0il Dice:
    Agosto 12, 2008 a las 10:05 pm

    Pero no me vas a contestar por qué existe dios, ni quién lo creó?



  40. Magufo dice:


    No es competencia de la ciencia encontar el porque surgio el universo. La ciencia puede averiguar como y en que momento, incluso cual era la configuracion inicial del universo primitivo, pero no tiene la ambicion de saber con que finalidad surgió, si es que tal finalidad existe. Eso es competencia de la filosofia y la metafisica.

    Así que a la ciencia no puedes reclamarle tal responsabilidad. No se que espectativas tienes puestas en la ciencia pero deberias saber que la ciencia tiene un ambito de acción y unos propositos muy claros, y es ahí donde funciona

    He llegado a la conclusion que GAC no es real, esta interpretando un papel porque no me creo que pueda haber personas tan fundamentalistas e ignorantes de cosas tan basicas como la evolucion…

    ¿Que opinais? ¿existe la tabla periodica de los elementos? Yo creo que es una farsa y en cuanto encuentre una web crisitana con las pruebas os lo demuestro…xD

  41. Magufo dice:


    Toma FALACIA. Hacemos una apuesta ok? yo te demuestro la inexistencia de Dios y tu me demuestras la inexistencia de unicornios rosas invisibles..

    Y yo te pregunto..El universo es perfecto, es armonico, es ordenado y maravilloso. Despues de toda esta belleza ¿como puedes negar la existencia de unicornios rosas invisibles? Hay cientos de paginas que hablan de unicornios rosas invisibles, miles de personas no pueden estar equivocadas.

    Porque no te documentas un poco? http://es.youtube.com/watch?v=tCUn03zuxrw&feature=related

    Y un poquito mas http://www.youtube.com/watch?v=iU4iZGOrURA

    Unicornio, perdonalos porque no saben lo que hacen

  42. Sencillo dice:

    Para magufo:

    Magufo dice:


    No es competencia de la ciencia encontar el porque surgio el universo. ”

    Entonces si no es competencia de la ciencia, como tu dices y hay otros muchos que dicen lo contrario ( que si es competencia de la ciencia ) ,entonces no puedes responder a la pregunta 1) ¿PORQUE SURGIÓ EL UNIVERSO? Y POR LO TANTO NO PUEDES DEMOSTRAR LA INEXISTENCIA DE DIOS COMO RESPUESTA LÓGICA A LA PREGUNTA 1) y por lo tanto esta entrada en este blog es obsoleta puesto que no puede responder a la pregunta 1).
    Si la ciencia no puede responder a esta pregunta por que no es competente para responderla según tu , ENTONCES A LO MEJOR ¿SERÁ COMPETENTENTE PARA RESPONDER A ESTA?. ¿ QUE HABÍA ANTES DE QUE SURGIESE EL UNIVERSO EN EL INSTANTE JUSTO ===ANTES=== DEL TIEMPO CUANDO T=0 ( T=TIEMPO ) ?

  43. Magufo dice:

    Señor Sencillo, le respondo a lo ultimo y dentro de un rato le respondere porque el ateismo y la ciencia no son otra forma de FE.


    La pregunta no tiene sentido, de hecho no tiene sentido siquiera preguntar algo asi, no se puede aplicar el concepto de “antes” en un universo con T=0, ¿lo entiende?

  44. Sencillo dice:

    Magufo Dice:


    La pregunta no tiene sentido, de hecho no tiene sentido siquiera preguntar algo asi, no se puede aplicar el concepto de “antes” en un universo con T=0, ¿lo entiende?

    Parece que no la ha entendido. Se la reformularé de forma más simple.

  45. Magufo dice:

    Sigue sin tener sentido plantearse esa pregunta, no hay un antes, el concepto de tiempo va ligado al del espacio, ergo solo pueden existir los “antes” y los “despues” una vez el espacio del universo existe, y con el, el tiempo.

    Quiza le parezca dificil de comprender.

  46. Magufo dice:

    Le recomiendo la lectura de “historia del tiempo” de Stephen Hawking donde lo explica claramente.

  47. Sencillo dice:


  48. Sencillo dice:

    Por que si no había nada ¿como es que de la nada surgió ALGO LLAMADO UNIVERSO CON UNA CANTIDAD DE ENERGÍA MENSURABLE NÚMERICAMENTE, ETC, ETC?

  49. Magufo dice:

    ¿Lo entiende? El tiempo empieza con el universo. No es correcto decir, “pasaron mil años y entonces surgio el universo” o “decadas antes del Big Bang…”

    Por si esto fuera poco, eintein aún añadio mas sustancia al concepto de tiempo, ligandolo con el de espacio, el espacio y el tiempo son dos caras de la misma moneda, no puede existir uno sin el otro. Logicamente el tiempo aparecio al mismo tiempo que el espacio, es decir, en el mismisimo instante del Big bang.

    No es mas que eso, pienselo

  50. Magufo dice:

    Ya veo que no lo entiende, se lo he explicado lo mejor que se dentro mis limitados conocimientos sobre el tema. Si de verdad le interesa saber sobre el tema use google, él es su amigo. Más no puedo hacer, su incredulidad personal o su dificultad para visualizarlo no puedo remediarlas, creo que con esto cerramos el tema, ¿no?

  51. Nimux Vale dice:

    Muerte a dios, democracia en el cielo

    Hay muchas cosas que no se, pero intento entenderlas y no me invento idolos catolicos para explicarlas, si no me las se, pues nada, es una tonteria darle vuelta a las palabras en vez de tocar la realidad.

    Lo que si se es lo que soy: soy un ente organico y quimico, sin nada diferente a cualquier otro animal, sin alma alguna.

    Si en el mundo no existieran los creyentes en idolos y dioses, todo sería mucho mejor, menos guerras, mas ecologismo, menos odio a las ideas, etc

    Soy un blasfemo ante los catolicos idolatras. je, je.

    (si me equivoco y hay un dios dictador y vengativo como dicen los catolicos, pues lucharé contra el hasta matarle y ya esta, montaré una democracia)

  52. Sencillo dice:

    Le recomiendo la lectura de “historia del tiempo” de Stephen Hawking donde lo explica claramente.

  53. Sencillo dice:


  54. airf0il dice:

    Estoy sinceramente maravillado. GAC, pretendes que me trague los argumentos de webs religiosas, no-neutrales y fanáticas, lanzados por cuatro lunáticos sin titulación? Pues no lo voy a hacer.

    He estado meditando una forma de que entiendas lo que te quiero decir. Bueno, yo y la comunidad científica.

    Pruebas evolución existir. Pruebas creacionismo no existir.

    Ahora, lo entiendes? Porque si sigues a la tuya, realmente no te quieres dar cuenta.

    Para Sencillo:

    Primero: vaya falacia que has metido, eh? Ya te lo ha dicho Magufo, no somos nosotros quienes tenemos que demostrar la inexistencia de dios, las negaciones no se prueban.

    Segundo. La ciencia no sabe qué había antes del universo. De hecho es un poco difícil imaginarse que había un antes, ya que cuando se inició el Big Bang toda la materia estaba condensada en un punto, con densidad infinita y sin tiempo.

    La ciencia no sabe que había antes. Pero tú tampoco.

    Tercero. Aunque la ciencia no sepa qué había antes (que tampoco es su cometido), demuestra eso la existencia de dios? No. De hecho, la afirmación de que dios creó el universo en unos días es algo totalmente falso, ya que hay pruebas de cómo se originó el universo (Big Bang) y las especies (evolución).

    Una cosa es dar una explicación fantasiosa a algo cuando no tiene ninguna explicación. Pero mantener esa explicación irracional cuando ya se ha descubierto la causa de ese algo, y qué es, es sencillamente una superstición que no lleva a nada.

    Puedes berrear todo lo que quieras, hacer las preguntas que quieras, postear los comentarios que quieras. Pero eso no va a cambiar la realidad, y la realidad es la que es. Le pese a quien le pese.

  55. Sencillo dice:


  56. Magufo dice:

    Por cierto airf0il, no lo comenté antes pero mi experiencia personal con la religión es muy parecida, con el añadido que yo si fui bautizado e hice la comunión, toma ya!!. Incluso después de comulgar acudí religiosamente a la iglesia cada domingo, pero solo porque haciendolo tenia recompensa económica para jugar a maquinas recreativas..

    No recuerdo como empeze a dejar de creer, supongo que la historia cayo por su propio peso a la que me empezo a interesar como funcionaban las cosas, la curiosidad mato al gato dicen, en mi caso mató a Dios. Y así me converti en ateao, ese despreciable ser inmoral carente de virtud y alma..xD

    Viva el unicornio rosa invisible, el que niegue su existencia es un blasfemo y su vida carece de sentido. La cuñada de la tia de mi prima lo vio porque tenia FE, un regalo que a vosotros no se os ha dado.

  57. airf0il dice:

    Le recomiendo la lectura de “historia del tiempo” de Stephen Hawking donde lo explica claramente.

    No entraré en asuntos de crítica literaria porque creo que usted se ha hecho toda la publicidad.

    Pero sí que diré que nadie tiene por qué demostrar la inexistencia de dios, con esas preguntas o con otras. Sencillamente, eso es una falacia.

    Tú tienes que aportar pruebas de que dios existe. Si todos usaramos tu “método”, como ya ha dicho magufo, nadie podría probar que los unicornios no existen. Y eso demuestra su existencia?

  58. airf0il dice:


    Puedes tú contestar a las preguntas que tú mismo has formulado? Porque si no, creo que esto es un diálogo para besugos…

  59. Magufo dice:

    Lo de contestar preguntas a uno mismo me ha recordado a esta noticia que he visto hoy en meneame

    Este es el enlace http://meneame.net/story/me-respondo-a-mi-mismo Como veis tiene mas de 200 comentarios, la batalla dialectica ha sido apoteosica, Cristians FAIL! xD.

    Este es el enlace al que nos envia la noticia cuando pinchamos en el titular, incluye un video cojonudo y muy divertido:

  60. Sencillo dice:


    “Para Sencillo:

    Primero: vaya falacia que has metido, eh? Ya te lo ha dicho Magufo, no somos nosotros quienes tenemos que demostrar la inexistencia de dios, las negaciones no se prueban. ”



    ¿Donde saco usted el título de lógica?. SIMPLEMENTE DANTESCO, DE PURA RISA.

    Primero: vaya falacia que has metido, eh? Ya te lo ha dicho Magufo, no somos nosotros quienes tenemos que demostrar la inexistencia de dios, las negaciones no se prueban. ”


    Pasemos página al lamentable y vergonzoso comentario suyo sobre que las negaciones no se prueban.
    Airf0il dice:
    “Segundo. La ciencia no sabe qué había antes del universo. De hecho es un poco difícil imaginarse que había un antes, ya que cuando se inició el Big Bang toda la materia estaba condensada en un punto, con densidad infinita y sin tiempo.”

  61. Magufo dice:


    Claro, todos podemos jugar a ver quien tiene mas imaginacion. Yo digo que habia unicornios rosas invisibles y airf0il creo que prefiere creer en gamusinos. ¿porque usted iba a tener mas razon? ¿es que nuestros amigos imaginarios son peores?


    Tienes razon, yo se una miseria pero la ciencia sabe lo suficiente como para permitirle expresarse libremente en un mundo virtual como es internet. Supongo q

  62. Magufo dice:


    Claro, todos podemos jugar a ver quien tiene mas imaginacion. Yo digo que habia unicornios rosas invisibles y airf0il creo que prefiere creer en gamusinos. ¿porque usted iba a tener mas razon? ¿es que nuestros amigos imaginarios son peores?


    Pues sí, eso si que lo tiene la ciencia, no es arrogante ni va de sabelotodo. Tiene un campo de accion y no otro que usted quiera atribuirle. Me parece que es un poco vago para informarse lo minimo sobre lo que es la ciencia, ¿se ha leido algo de wikipedia sobre el metodo cientifico?

    Es como si estuviera hablando con alguien que se queja de que compar tomates es tirar el dinero ya que no pueden usarse para hacer zumo de limon, o que las hojas de papel no sirven para nada porque con ella no se pueden construir rascacielos

  63. Magufo dice:

    Comentario duplicado airf0il, lo siento. Si eres tan amable de borrar el primero de los dos plis. Gracias.

  64. GAC dice:

    Lo que hay que aguantar.

    Vamos a ver, intentaré ser lo mas lógico – científico posible.

    Veo que las páginas “cristianas” que curiosamente enlazan a otras páginas .. científicas no os valen.

    Bueno pues razonaré la cosa de otra forma.. Pegando las partes del texto que me interesa que vean para probar lo que digo.

    Porque no soy como afirma Magufo fundamentalista e ignorante.

    Porque aporto pruebas de lo que digo, cosa que por cierto pocas veces se vé en vosotros, mucho discurso de lo fanáticos que

    somos pero nada todo palabrerío.

    Falacia de la aparición de la primera célula viva de materia muerta.

    “De hecho, se ha demostrado que es imposible que la primera célula viva, ni tan siquiera una de las millones de moléculas

    proteicas de esa célula, hayan aparecido por casualidad. Esto ha sido demostrado no sólo mediante experimentos y

    observaciones, sino también con cálculos matemáticos de probabilidad. En otras palabras, la evolución se colapsa al primer

    paso: explicar la aparición de la primera célula viva.”

    “Otro dilema terrible desde el punto de vista de la evolución es la molécula de ADN que hay en el núcleo de la célula, un

    sistema codificado con 3.500 millones de unidades que contiene todos los detalles de la vida. El ADN se descubrió en las

    décadas de los 40 y 50 utilizando cristalografía de rayos X, y es una molécula gigante con un plan y un diseño soberbios.

    Durante muchos años, Francis Crick, galardonado con el premio Nobel, creyó en la teoría de la evolución molecular, pero en

    un momento dado tuvo que admitir que una molécula tan compleja no podía haber aparecido espontáneamente por casualidad como

    resultado de un proceso evolutivo:

    Hombre honesto, armado con todos los conocimientos que tenemos a nuestra disposición hoy en día, sólo pudo decir que, en

    cierto sentido, la aparición de la vida actualmente parece ser casi un milagro.1

    El catedrático evolucionista turco Ali Demisroy no tuvo más remedio que hacer la siguiente confesión sobre este tema:

    De hecho, la probabilidad de formación de una proteína y un ácido nucleico (ADN-ARN) es más pequeña de lo que podemos

    calcular. Es más: las posibilidades de que aparezca una cadena proteica determinada son tan pequeñas que las podemos

    calificar de astronómicas. 2”

    Homer Jacobson, catedrático emérito de química, admite lo siguiente en relación a la imposibilidad de que la vida apareciera

    por casualidad


    El registro fósil representa otra derrota aplastante para la teoría de la evolución. Entre todos los fósiles descubiertos en

    el transcurrir de los años, no hay ni un solo ejemplo de las formas intermediarias que serían necesarias si, tal y como

    defiende la teoría de la evolución, los seres vivos hubieran evolucionado paso a paso de especies simples a otras más

    complejas. Si estas criaturas hubieran existido, habría habido millones e incluso billones. Es más: los restos de estas

    criaturas deberían aparecer en el registro fósil. Si estas formas intermedias hubieran existido realmente, habrían sido

    muchas más que las especies animales que conocemos hoy en día, y sus restos fósiles deberían encontrarse en todas partes del

    mundo. Los evolucionistas han estado buscando estas formas intermedias en una febril investigación fósil que se lleva a cabo

    desde el siglo XIX. Sin embargo, a pesar de la búsqueda ávida de losúltimos 150 años, no hay rastro alguno de estas formas



    Richard Monastersky, escritor de la revista Science News, dice lo siguiente acerca de la explosión cámbrica, que es una

    trampa mortal para la teoría de la evolución:

    Hace quinientos millones de años… aparecieron los animales de formas marcadamente complejas que conocemos hoy. Este momento,

    al principio de la era cámbrica de la Tierra, hace aproximadamente 550 millones de años, marca la explosión evolutiva que

    llenó los mares con las primeras criaturas complejas.7

    Phillip Johnson, catedrático en la Universidad de Berkeley, en California, y uno de los principales críticos del darwinismo,

    describe la contradicción entre este hecho palenteológico y el darwinismo:

    La teoría darviniana predice un “cono de diversidad creciente”, ya que el primer organismo viviente, o las primeras especies

    animales, se diversificaron gradual y continuamente hasta crear los niveles más altos del orden taxonómico. El registro

    fósil animal parece más bien un cono decreciente, en el que los phyla presentes al principio han ido disminuyendo en número.


    Desde principios del SXX, los evolucionistas han representado a los neandertales como criaturas simiescas, una raza humana

    desaparecida. Durante décadas utilizaron esta imagen de los neandertales como propaganda evolucionista. Sin embargo, a

    partir de los años 1980 este mito empezó a quebrarse. Tanto los estudios fósiles como los restos de la cultura neandertal

    han demostrado que esta gente no eran medio monos. Por ejemplo, esta aguja de hace 26.000 años demuestra que los

    neandertales eran hombres civilizados que tenían la capacidad de coser. Como resultado de estos descubrimientos,

    publicaciones evolucionistas como National Geographic tuvieron que empezar a representarles como seres civilizados, como en

    la ilustración inferior.


    Cada nuevo descubrimiento fósil acorrala aún más a los evolucionistas, aunque algunas publicaciones de talante frívolo

    publiquen titulares como “Descubierto un eslabón perdido”. La calavera fósil llamada Kenyanthropus platyops descubierta en

    el 2001 es el último ejemplo. El palenteólogo evolucionista Daniel E. Lieberman del Departamento de Antropología de la

    Universidad de Washington hizo estas declaraciones acerca de Kenyanthropus platyops (declaraciones publicadas en la

    destacada revista científica Nature):

    A pesar de 150 años de propagandísticas investigaciones evolucionistas acerca del origen del hombre, los fósiles

    descubiertos muestran que los primeros humanos aparecieron de repente en la Tierra, sin ningún “ancestro parecido a un

    mono”. Las tres distintas hipótesis de esta página ilustran tres escenarios evolutivos distintos y contradictorios (Stephen

    Jay Gould, The Book of Life, 2001). Si miramos atentamente veremos que hay un signo de interrogación delante de Homo

    erectus, que se muestra como la primera raza humana sobre la Tierra. El motivo de ello es que no hay ninguna criatura

    “parecida a un mono” que los evolucionistas puedan mostrar como “ancestro del hombre”. Las especies de las ilustraciones,

    que no tienen ningún tipo de relación con el hombre, en realidad son especies extintas de mono. El origen del hombre, como

    podemos ver, es un misterio para los evolucionistas, porque su origen no es la evolución, sino la creación.

    Tim Beardsley ha publicado recientemente, en la revista Investigación y Ciencia, un artículo titulado Genes inteligentes*.

    El problema que se plantea es el de ladiferenciación: ¿cómo se explica que genes muy parecidos produzcan células muy


    h ttp://www.unav.es/cryf/nuevosavancesenbiologiamolecular.html

    Collins se une así a una línea de científicos cuyos descubrimientos han contribuido a reafirmar su fe en Dios. Isaac Newton,

    cuyo descubrimiento de las leyes de la gravedad “reorganizó” nuestra manera de entender el universo, fue uno de ellos.

    Newton aseguró que “el sistema más bello sólo podría proceder del dominio de un ser inteligente y poderoso”. Otro de ellos

    fue Albert Einstein, que revolucionó nuestro entendimiento del tiempo, de la gravedad y de la conversión de la materia en

    energía. Einstein creía que el universo tenía un Creador: “Quiero saber cómo creó Dios el universo, quiero conocer Sus

    pensamientos; el resto son detalles”, escribió.

    Aquí os pongo un blog cristiano, sí cristiano en el que el director del proyecto genoma Humano Francis Collins que dice bien


    El conocimiento científico complementa la fe en Dios, en lugar de contradecirla

    desmonta todas vuestras chorradas fantásticas sobre el hombre que viene del mono que a su vez viene de la casualidad del

    arbol evolutivo creado a partir de materia muerta.

    Solo pensar en semejante imbecilidad debería haceros sentir vergüenza pero como sé que teneis fé ciega en el ateismo

    evolutivo.. os aconsejo leer este artículo.. Se contesta incluso a las “tesis” de vuestro amor Dawkins..

    h ttp://apologista.blogdiario.com/1215818280/

    Los graves problemas que afectan a teoría darwinista ante los avances de la genética y la paleontogía son afrontados por sus

    defensores de dos formas, unos simplemente ignoran la realidad, otros más listos e informados tratan de hacer que algo

    cambie en la doctrina para que todo siga igual, que pueda salvarse lo fundamental. Unos son los dogmáticos y otros los

    Lo fundamental en el darwinismo es el azar como motor del cambio evolutivo, no nos engañemos, si la supervivencia de los más

    aptos no sirve como explicación se cambia por la reproducción diferencial, todo eso no tiene la menor importancia.

    Sampedro no es un estúpido ni un ignorante, muy al contrario, sabe que las “variantes ventajosas”, no llevarán al primitivo

    procariota a convertirse en un elefante o en una almeja, por mucho que demos tiempo al tiempo y que los enormes bloques de

    información genética sustantiva aparecen de pronto para ser utilizados en el futuro, por eso abandonó el darwinismo y se

    pasó a la evolución modular.

    Los módulos de genes Hox con sus baterías de genes downstream son difícilmente concebibles como aparecidos al azar, pero

    ¡Ay! Sampedro es ante todo y sobre todo ateo, eso lo repite mucho. Ateo y acojonado por el qué dirán.

    Leyendo su deconstrucción de Darwin lo vemos claro. Ante la acusación de Dennett a Gould de poseer una agenda oculta de

    intereses- morales, politicos, religiosos- por dudar del poder omnimodo de la selección natural ( estos darwinistas

    matándose mutuamente como stalinistas y troskistas)
    Sampedro escribe: “Yo era un darwinista ortodoxo y convencido, y ahora he dejado de serlo ¿Qué objetivos ocultos han guiado

    mi pérdida de fe? Era entonces y sigo siendo un correoso ateo, un izquierdista moderado y un amante del jazz. Darwin sigue

    siendo un modelo intelectual para mi, y sigo valorando el darwinismo como lo que es: un sólido argumento matemático para

    compatibilizar la naturaleza discreta del gen con el gradualismo darwiniano. ¿Cuáles son entonces mis objetivos ocultos? Mi

    fe en el darwinismo se ha disipado por las más grises, planas y aburridas razones científicas”

    Pobre hombre sin fe, arrastrándose a publicar esos infames artículos solo para evitar ser arrojado definitivamente a las

    tinieblas exteriores. Muchos de ustedes no saben lo que este pobre hombre ha padecido por deconstruir a Darwin, se comprende

    esta vuelta a la iglesia aunque sea poco sincera.

    La guinda al final: el fervoroso cristiano y darwinista creyente Francis Collins no ha sido liberado de un creador

    sobrenatural por la doctrina darwinista, lo que demuestra que esta no libera todo lo que parece, pero Sampedro en su agonía

    es un espécimen único digno de estudio y observación, creyente solo en su ateísmo correoso, liberado por Darwin pero lleno

    de dudas y de módulos que no encajan.

    h ttp://evolucion-y-darwinismo.blogspot.com/

    Ya me canso..





    Conclusión: La terquedad atea mas ráncia que no solo no reconoce la evidencia sino que la esquiva como bien dice SENCILLO

    por la tangente no me deja otro remedio ante la negativa a refutar todas las prueabas que les he presentado que a pensar y

    decir aquí publicamente que :

    1º Son unos mentirosos, primero piden pruebas y una vez que las tienen las niegan.. No quieren conocer la verdad solo gente

    que apoye “su verdad”… Por ende son ustedes una secta no me queda ya ningun resquicio para no estar convencido de ello.

    2º Como toda buena secta se dedican a descalificar a todo aquel que ose denunciar sus mentiras o razonar con ustedes.

    3º La gran hipocresía que muestran al denunciar a los “MAGUFOS” o mentirosos de otros blogs cuando ustedes no hacen mas que

    mentir en el suyo y porsupuesto cuando quedan en evidencia recurren al: GAC te estas poniendo pesado eres un fanático, o

    similar.. en lugar de refutar las pruebas que se les presentan..

    4º Piden ciencia y con la ciencia les demuestro una y otra vez como mienten..

    Mintieron con las amalgamas, mintieron con el 11S, mintieron cuando afirman que no hay tecnología para modificar el clima,

    mintieron al negar que China fuese a utilizar aviones para que no lloviese que luego tuvieron que retractarse al mostrarles

    otro forero una noticia que les dejaba en evidencia.

    Siguen mintiendo patológicamente afirmando que Dios es igual que un unicornio o las hadas porque como no se le puede probar

    estan al mismo nivel.. Pero esquivan el argumento de las profecías cumplidas ante el que no tienen ninguna escapatoria.

    Mintieron cuando uno de vosotros dijo que la Biblia había sido modificada con el paso de los siglos.. demostré que eso era

    falso con la presentación de la noticia de los rollos del mar muerto.

    Son ustedes unos mentirosos patológicos carentes de cualquier credibilidad, sinceramente si no aparece mas gente sensata con

    la que poder debatir me plantearé aunque no me censuren el abandonar esta secta-blog ya que no solo no me aportan nada sino

    que pretenden convencerme de sus mentiras solo a base de descalificaciones y de cuestionar mis conocimientos y mis fuentes.

    No ponen una sola prueba de lo que dicen que no sea facilmente desmontada.. Cuando le hablé a Airfoil sobre la ciencia y sus

    terribles usos le cité la IBM y los nazis.. trató de darme lecciones hablandome de que los ordenadores se usaban de aquella

    para cálculos militares..

    Otra vez .. utilizaron lo de ver la paja en el ojo ajeno y no la viga en el propio ya que no entendieron a que me refería..

    pero no dudaron en llamarme ignorante y decirme “que me había cubierto de gloria”.

    ¿Que tendría que pensar yo de ustedes a la luz de la evidencia en todo esto que les digo?..

    Si utilizase su misma bara de medir y sacase a cada punto y cada coma inexacto en lo que dicen un pretexto para criticarles

    no podría parar hasta haber escrito toda la enciclopedia británica en volumen de texto.

    No quieren ver mas allá de sus narices por lo cual intuyo que jamas creerán en Dios porque son incapaces de creer en el

    resto de la humanidad.. solo cogen lo que les interesa creer y desechan el resto.. lo cual es otra forma de hipocresía.. al

    autoproclamarse ustedes.. científicos.. o buscadores de “la verdad”..

    Hasta otra.. Porfavor dejen de estafar a la gente.. o al menos cuando afirmen cosas que sea información veraz y no la maraña

    de mentiras y medias verdades tendenciosas actual.


  65. GAC dice:

    Lo que hay que aguantar.

    Vamos a ver, intentaré ser lo mas lógico – científico posible.

    Veo que las páginas “cristianas” que curiosamente enlazan a otras páginas .. científicas no os valen.

    Bueno pues razonaré la cosa de otra forma.. Pegando las partes del texto que me interesa que vean para probar lo que digo.

    Porque no soy como afirma Magufo fundamentalista e ignorante.

    Porque aporto pruebas de lo que digo, cosa que por cierto pocas veces se vé en vosotros, mucho discurso de lo fanáticos que somos pero nada todo palabrerío.

    Falacia de la aparición de la primera célula viva de materia muerta.

    “De hecho, se ha demostrado que es imposible que la primera célula viva, ni tan siquiera una de las millones de moléculas proteicas de esa célula, hayan aparecido por casualidad. Esto ha sido demostrado no sólo mediante experimentos y observaciones, sino también con cálculos matemáticos de probabilidad. En otras palabras, la evolución se colapsa al primer paso: explicar la aparición de la primera célula viva.”

    “Otro dilema terrible desde el punto de vista de la evolución es la molécula de ADN que hay en el núcleo de la célula, un sistema codificado con 3.500 millones de unidades que contiene todos los detalles de la vida. El ADN se descubrió en las décadas de los 40 y 50 utilizando cristalografía de rayos X, y es una molécula gigante con un plan y un diseño soberbios. Durante muchos años, Francis Crick, galardonado con el premio Nobel, creyó en la teoría de la evolución molecular, pero en un momento dado tuvo que admitir que una molécula tan compleja no podía haber aparecido espontáneamente por casualidad como resultado de un proceso evolutivo:

    Hombre honesto, armado con todos los conocimientos que tenemos a nuestra disposición hoy en día, sólo pudo decir que, en cierto sentido, la aparición de la vida actualmente parece ser casi un milagro.1

    El catedrático evolucionista turco Ali Demisroy no tuvo más remedio que hacer la siguiente confesión sobre este tema:

    De hecho, la probabilidad de formación de una proteína y un ácido nucleico (ADN-ARN) es más pequeña de lo que podemos calcular. Es más: las posibilidades de que aparezca una cadena proteica determinada son tan pequeñas que las podemos calificar de astronómicas. 2”

    Homer Jacobson, catedrático emérito de química, admite lo siguiente en relación a la imposibilidad de que la vida apareciera por casualidad


    El registro fósil representa otra derrota aplastante para la teoría de la evolución. Entre todos los fósiles descubiertos en el transcurrir de los años, no hay ni un solo ejemplo de las formas intermediarias que serían necesarias si, tal y como defiende la teoría de la evolución, los seres vivos hubieran evolucionado paso a paso de especies simples a otras más complejas. Si estas criaturas hubieran existido, habría habido millones e incluso billones. Es más: los restos de estas criaturas deberían aparecer en el registro fósil. Si estas formas intermedias hubieran existido realmente, habrían sido muchas más que las especies animales que conocemos hoy en día, y sus restos fósiles deberían encontrarse en todas partes del mundo. Los evolucionistas han estado buscando estas formas intermedias en una febril investigación fósil que se lleva a cabo desde el siglo XIX. Sin embargo, a pesar de la búsqueda ávida de losúltimos 150 años, no hay rastro alguno de estas formas intermedias.


    Richard Monastersky, escritor de la revista Science News, dice lo siguiente acerca de la explosión cámbrica, que es una trampa mortal para la teoría de la evolución:

    Hace quinientos millones de años… aparecieron los animales de formas marcadamente complejas que conocemos hoy. Este momento, al principio de la era cámbrica de la Tierra, hace aproximadamente 550 millones de años, marca la explosión evolutiva que llenó los mares con las primeras criaturas complejas.7

    Phillip Johnson, catedrático en la Universidad de Berkeley, en California, y uno de los principales críticos del darwinismo, describe la contradicción entre este hecho palenteológico y el darwinismo:

    La teoría darviniana predice un “cono de diversidad creciente”, ya que el primer organismo viviente, o las primeras especies animales, se diversificaron gradual y continuamente hasta crear los niveles más altos del orden taxonómico. El registro fósil animal parece más bien un cono decreciente, en el que los phyla presentes al principio han ido disminuyendo en número.


    Desde principios del SXX, los evolucionistas han representado a los neandertales como criaturas simiescas, una raza humana desaparecida. Durante décadas utilizaron esta imagen de los neandertales como propaganda evolucionista. Sin embargo, a partir de los años 1980 este mito empezó a quebrarse. Tanto los estudios fósiles como los restos de la cultura neandertal han demostrado que esta gente no eran medio monos. Por ejemplo, esta aguja de hace 26.000 años demuestra que los neandertales eran hombres civilizados que tenían la capacidad de coser. Como resultado de estos descubrimientos, publicaciones evolucionistas como National Geographic tuvieron que empezar a representarles como seres civilizados, como en la ilustración inferior.


    Cada nuevo descubrimiento fósil acorrala aún más a los evolucionistas, aunque algunas publicaciones de talante frívolo publiquen titulares como “Descubierto un eslabón perdido”. La calavera fósil llamada Kenyanthropus platyops descubierta en el 2001 es el último ejemplo. El palenteólogo evolucionista Daniel E. Lieberman del Departamento de Antropología de la Universidad de Washington hizo estas declaraciones acerca de Kenyanthropus platyops (declaraciones publicadas en la destacada revista científica Nature):

    A pesar de 150 años de propagandísticas investigaciones evolucionistas acerca del origen del hombre, los fósiles descubiertos muestran que los primeros humanos aparecieron de repente en la Tierra, sin ningún “ancestro parecido a un mono”. Las tres distintas hipótesis de esta página ilustran tres escenarios evolutivos distintos y contradictorios (Stephen Jay Gould, The Book of Life, 2001). Si miramos atentamente veremos que hay un signo de interrogación delante de Homo erectus, que se muestra como la primera raza humana sobre la Tierra. El motivo de ello es que no hay ninguna criatura “parecida a un mono” que los evolucionistas puedan mostrar como “ancestro del hombre”. Las especies de las ilustraciones, que no tienen ningún tipo de relación con el hombre, en realidad son especies extintas de mono. El origen del hombre, como podemos ver, es un misterio para los evolucionistas, porque su origen no es la evolución, sino la creación.

    Tim Beardsley ha publicado recientemente, en la revista Investigación y Ciencia, un artículo titulado Genes inteligentes*. El problema que se plantea es el de ladiferenciación: ¿cómo se explica que genes muy parecidos produzcan células muy diferentes?

    h ttp://www.unav.es/cryf/nuevosavancesenbiologiamolecular.html

    Collins se une así a una línea de científicos cuyos descubrimientos han contribuido a reafirmar su fe en Dios. Isaac Newton, cuyo descubrimiento de las leyes de la gravedad “reorganizó” nuestra manera de entender el universo, fue uno de ellos. Newton aseguró que “el sistema más bello sólo podría proceder del dominio de un ser inteligente y poderoso”. Otro de ellos fue Albert Einstein, que revolucionó nuestro entendimiento del tiempo, de la gravedad y de la conversión de la materia en energía. Einstein creía que el universo tenía un Creador: “Quiero saber cómo creó Dios el universo, quiero conocer Sus pensamientos; el resto son detalles”, escribió.

    Aquí os pongo un blog cristiano, sí cristiano en el que el director del proyecto genoma Humano Francis Collins que dice bien claro..

    El conocimiento científico complementa la fe en Dios, en lugar de contradecirla

    desmonta todas vuestras chorradas fantásticas sobre el hombre que viene del mono que a su vez viene de la casualidad del arbol evolutivo creado a partir de materia muerta.

    Solo pensar en semejante imbecilidad debería haceros sentir vergüenza pero como sé que teneis fé ciega en el ateismo evolutivo.. os aconsejo leer este artículo.. Se contesta incluso a las “tesis” de vuestro amor Dawkins..

    h ttp://apologista.blogdiario.com/1215818280/

    Los graves problemas que afectan a teoría darwinista ante los avances de la genética y la paleontogía son afrontados por sus defensores de dos formas, unos simplemente ignoran la realidad, otros más listos e informados tratan de hacer que algo cambie en la doctrina para que todo siga igual, que pueda salvarse lo fundamental. Unos son los dogmáticos y otros los reformistas.
    Lo fundamental en el darwinismo es el azar como motor del cambio evolutivo, no nos engañemos, si la supervivencia de los más aptos no sirve como explicación se cambia por la reproducción diferencial, todo eso no tiene la menor importancia.

    Sampedro no es un estúpido ni un ignorante, muy al contrario, sabe que las “variantes ventajosas”, no llevarán al primitivo procariota a convertirse en un elefante o en una almeja, por mucho que demos tiempo al tiempo y que los enormes bloques de información genética sustantiva aparecen de pronto para ser utilizados en el futuro, por eso abandonó el darwinismo y se pasó a la evolución modular.

    Los módulos de genes Hox con sus baterías de genes downstream son difícilmente concebibles como aparecidos al azar, pero ¡Ay! Sampedro es ante todo y sobre todo ateo, eso lo repite mucho. Ateo y acojonado por el qué dirán.

    Leyendo su deconstrucción de Darwin lo vemos claro. Ante la acusación de Dennett a Gould de poseer una agenda oculta de intereses- morales, politicos, religiosos- por dudar del poder omnimodo de la selección natural ( estos darwinistas matándose mutuamente como stalinistas y troskistas)
    Sampedro escribe: “Yo era un darwinista ortodoxo y convencido, y ahora he dejado de serlo ¿Qué objetivos ocultos han guiado mi pérdida de fe? Era entonces y sigo siendo un correoso ateo, un izquierdista moderado y un amante del jazz. Darwin sigue siendo un modelo intelectual para mi, y sigo valorando el darwinismo como lo que es: un sólido argumento matemático para compatibilizar la naturaleza discreta del gen con el gradualismo darwiniano. ¿Cuáles son entonces mis objetivos ocultos? Mi fe en el darwinismo se ha disipado por las más grises, planas y aburridas razones científicas”

    Pobre hombre sin fe, arrastrándose a publicar esos infames artículos solo para evitar ser arrojado definitivamente a las tinieblas exteriores. Muchos de ustedes no saben lo que este pobre hombre ha padecido por deconstruir a Darwin, se comprende esta vuelta a la iglesia aunque sea poco sincera.

    La guinda al final: el fervoroso cristiano y darwinista creyente Francis Collins no ha sido liberado de un creador sobrenatural por la doctrina darwinista, lo que demuestra que esta no libera todo lo que parece, pero Sampedro en su agonía es un espécimen único digno de estudio y observación, creyente solo en su ateísmo correoso, liberado por Darwin pero lleno de dudas y de módulos que no encajan.

    h ttp://evolucion-y-darwinismo.blogspot.com/

    Ya me canso..




    Conclusión: La terquedad atea mas ráncia que no solo no reconoce la evidencia sino que la esquiva como bien dice SENCILLO por la tangente no me deja otro remedio ante la negativa a refutar todas las prueabas que les he presentado que a pensar y decir aquí publicamente que :

    1º Son unos mentirosos, primero piden pruebas y una vez que las tienen las niegan.. No quieren conocer la verdad solo gente que apoye “su verdad”… Por ende son ustedes una secta no me queda ya ningun resquicio para no estar convencido de ello.

    2º Como toda buena secta se dedican a descalificar a todo aquel que ose denunciar sus mentiras o razonar con ustedes.

    3º La gran hipocresía que muestran al denunciar a los “MAGUFOS” o mentirosos de otros blogs cuando ustedes no hacen mas que mentir en el suyo y porsupuesto cuando quedan en evidencia recurren al: GAC te estas poniendo pesado eres un fanático, o similar.. en lugar de refutar las pruebas que se les presentan..

    4º Piden ciencia y con la ciencia les demuestro una y otra vez como mienten..

    Mintieron con las amalgamas, mintieron con el 11S, mintieron cuando afirman que no hay tecnología para modificar el clima, mintieron al negar que China fuese a utilizar aviones para que no lloviese que luego tuvieron que retractarse al mostrarles otro forero una noticia que les dejaba en evidencia.

    Siguen mintiendo patológicamente afirmando que Dios es igual que un unicornio o las hadas porque como no se le puede probar estan al mismo nivel.. Pero esquivan el argumento de las profecías cumplidas ante el que no tienen ninguna escapatoria.

    Mintieron cuando uno de vosotros dijo que la Biblia había sido modificada con el paso de los siglos.. demostré que eso era falso con la presentación de la noticia de los rollos del mar muerto.

    Son ustedes unos mentirosos patológicos carentes de cualquier credibilidad, sinceramente si no aparece mas gente sensata con la que poder debatir me plantearé aunque no me censuren el abandonar esta secta-blog ya que no solo no me aportan nada sino que pretenden convencerme de sus mentiras solo a base de descalificaciones y de cuestionar mis conocimientos y mis fuentes.

    No ponen una sola prueba de lo que dicen que no sea facilmente desmontada.. Cuando le hablé a Airfoil sobre la ciencia y sus terribles usos le cité la IBM y los nazis.. trató de darme lecciones hablandome de que los ordenadores se usaban de aquella para cálculos militares..

    Otra vez .. utilizaron lo de ver la paja en el ojo ajeno y no la viga en el propio ya que no entendieron a que me refería.. pero no dudaron en llamarme ignorante y decirme “que me había cubierto de gloria”.

    ¿Que tendría que pensar yo de ustedes a la luz de la evidencia en todo esto que les digo?..

    Si utilizase su misma bara de medir y sacase a cada punto y cada coma inexacto en lo que dicen un pretexto para criticarles no podría parar hasta haber escrito toda la enciclopedia británica en volumen de texto.

    No quieren ver mas allá de sus narices por lo cual intuyo que jamas creerán en Dios porque son incapaces de creer en el resto de la humanidad.. solo cogen lo que les interesa creer y desechan el resto.. lo cual es otra forma de hipocresía.. al autoproclamarse ustedes.. científicos.. o buscadores de “la verdad”..

    Hasta otra.. Porfavor dejen de estafar a la gente.. o al menos cuando afirmen cosas que sea información veraz y no la maraña de mentiras y medias verdades tendenciosas actual.


  66. Heli dice:

    Letras mayúsculas y argumentos medalaganistas que no pueden soportar su propia crítica (Sencillo exige unas condiciones que tampoco podría soportar su doctrina sobre la “creación del cosmos”), esto es lo de machacar con la pajita en el ojo y no ver la viga… ¡y luego le llaman a uno necio y prepotente cuando ellos te plantan un dios sin prueba alguna más que decir que nadie sabe nada sobre los orígenes ¡nadie salvo ellos claro! ¡Ole la prepotencia!. Me juego el bigote a que sufren ustedes el azote de evangélicos :S

  67. sbas dice:

    Con el debido respeto a los creyentes pero ninguno a diosetes y sus religiones…menos aún a sus auto erigidos representantes

    _vaya diosillo que, obrando milagros, debe producir el universo empleando seis días en el menester, encima, el muy… infinito y poderosísimo; va, se cansa y necesita un día para recuperarse del esfuerzo. Encima le salen respondones (¿chungos, defectuosos?) algunos de ellos y tiene que mandarlos al infierno…_- bueno se supone que eso lo debía tener previsto ya el mozo- aunque no se revela el momento en que lo fabrico. También hoy hasta el Vaticano abriga dudas de su existencia (pero esa sería cuestión para otro momento. ¡Que poco de deidad tiene esa forma de actuar!
    Revisad vuestros panfletos (Ledger & Bussines Plan de marketing) están caducos para mentes inteligentes.

  68. sbas dice:

    Por chungos y cascados de fábrica, me refiero sólo a los primeros angelillos que no pasaron el control de calidad.

  69. sbas dice:

    _No puedo evitarlo, tengo que soltarlo.
    Desde que llegue a Barcelona, la pasada semana, veo en todas las cocinas de restaurantes cocineros indios, paquistaníes y … especulo:
    _ ¿Qué pensará –sentirá- el mozo del fogón cuando está asando chuletas de su dios para alimentar a los clientes?
    _ ¿Cómo sabrá si están al punto si jamás las probó ni se le ocurrirá hacerlo?

  70. Manuel Abeledo dice:

    GAC, estás mezclando cosas. Por una parte citas textos de es.charla.religion y por otra a Francis Collins. Por cierto, el señor que escribe en Evolucion y Darwinismo tiene de biólogo lo que yo tengo de sacerdote baptista.

    Por otra parte, Francis Collins no niega que la evolución sea un hecho y Einstein era panteísta, que no creyente. Entre otras cosas, el físico alemán tildaba la religión de “superstición infantil”.

    Y todas las páginas anteriores que has enlazado son de origen fundamentalista cristiano. ¿En serio crees que alguien puede tomarse en serio un texto de Apologetic press, ignorando artículos de científicos reconocidos publicados en Scientific American, por ejemplo? Por favor, seamos serios.

    Por lo demás ni me voy a molestar. La evolución es un hecho, y si no lo fuese algunos fenómenos serían auténticos milagros, como la ya mencionada aparición de patógenos resistentes a los antibióticos. La teoría sintética de la evolución es la que mejor explica la aparición de nuevas especies y el creacionismo es, simple y llanamente, basura científicamente hablando.

    Lo que sí me gustaría que hicieses, GAC, es que si piensas que la teoría de la evolución y la evolución misma son falsas dejes de tomar antibióticos. A fin de cuentas todo eso de la evolución es mentira, ¿no?

  71. Sencillo dice:

    sbas Dice:
    Agosto 13, 2008 a las 2:18 am

    Con el debido respeto a los creyentes pero ninguno a diosetes y sus religiones…menos aún a sus auto erigidos representantes

    _vaya diosillo que, obrando milagros, debe producir el universo empleando seis días en el menester, encima, el muy… infinito y poderosísimo; va, se cansa y necesita un día para recuperarse del esfuerzo. Encima le salen respondones (¿chungos, defectuosos?) algunos de ellos y tiene que mandarlos al infierno…_- bueno se supone que eso lo debía tener previsto ya el mozo- aunque no se revela el momento en que lo fabrico. También hoy hasta el Vaticano abriga dudas de su existencia (pero esa sería cuestión para otro momento. ¡Que poco de deidad tiene esa forma de actuar!
    Revisad vuestros panfletos (Ledger & Bussines Plan de marketing) están caducos para mentes inteligentes.

    Señor Sbas yo estoy hablando sobre determinadas preguntas científicas que nadie me ha respondido. No estoy hablando sobre la interpretación de determinados textos, en ste caso la Biblia.
    2) Yo no “comulgo” con el vaticano, ni evangelistas, testigo de jehova ni CON NUNGUNA ASOCIACIÓN RELIGIOSA ETC, ETC.
    3) Esta usted mezclando churras con merinas. ¿Hable yo del infierno,EL CUAL ES UNA FALACIA MENTIROSA PRESENTADA POR LA JERARQUÍA CATÓLICA ?. No, yo no hable del infierno. Vuelvo a lo mismo: sigo esperando respuestas para las preguntas científicas que hice y que nadie en este blog es capaz de responder.

    Heli Dice:
    Agosto 13, 2008 a las 2:14 am

    Letras mayúsculas y argumentos medalaganistas que no pueden soportar su propia crítica (Sencillo exige unas condiciones que tampoco podría soportar su doctrina sobre la “creación del cosmos”), esto es lo de machacar con la pajita en el ojo y no ver la viga… ¡y luego le llaman a uno necio y prepotente cuando ellos te plantan un dios sin prueba alguna más que decir que nadie sabe nada sobre los orígenes ¡nadie salvo ellos claro! ¡Ole la prepotencia!. Me juego el bigote a que sufren ustedes el azote de evangélicos :S
    Cuando responda a esta pregunta podremos seguir hablando. Tampoco usted responde a las preguntas científicas que he realizado. NO PUEDEN PROBAR, SOLO VERBORREA BARATA, FILOSOFÍA PUERIL, NO CIENCIA, NO PRUEBAS.
    Al grano, la expresión matemática: 32 X ( Masa Planck )^2/ tan A = ( Masa Tierra )^2

    Donde tan A = tangente curvatura espacio-tiempo producida por una masa igual a la del electrón y a una distancia igual al radio terrestre ecuatorial.

    Le aligeraré el trabajo: tang x en función de la masa y la distancia, SEGÚN LA TEORÍA DE LA RELATIVIDAD GENERAL ES: tan x = ( 4 x M x Gn )/ ( c^2 x d ) ;
    donde M = masa , Gn = constante gravitación Newton, c = velocidad luz en el vacio y
    d = distancia.
    Responda usted a la pregunta CIENTÍFICA QUE LE HE REALIZADO, aunque le adelanto parte de la respuesta que ESA EXPRESIÓN MATEMÁTICA ES IMPOSIBLE QUE SEA CASUAL, ES CAUSAL, y el significado de la misma.
    Respondan de una vez a las preguntas que se les hicieron y a esta nueva pregunta

  72. Sencillo dice:

    Y en cuanto a la peregrina teoría-fiasco de la evolución: Los humanos sabemos por experiencia que donde hay un
    mensaje, éste tiene que haber sido emitido por una inteligencia. Ningún
    otro argumento basta para explicar la existencia del mismo. No recibimos
    cartas de un remitente aleatorio y errante. Ello, por tanto, implica que el ADN –un
    mensaje– es fruto de una concepción inteligente. “Sabemos
    por experiencia que cuando hay diseño, tiene que haber un diseñador”.

  73. Sencillo dice:

    La existencia de Dios no es algo que dependa de la Fe. Yo no he llegado a la conclusión de la existencia de Dios por la Fe, por la religion o por creencia, sino por una deducción lógica y racional. Así pues soy teísta, pero no se puede decir que sea creyente, ya que mi defensa de la existencia de Dios se debe no a la Fe sino a deducción basada en la lógica y en la razón.

    La razón por la que obligatoriamente tiene que existir Dios es porque es la única respuesta posible ante los datos aportados por la ciencia, en especial la ciencia física, la biología, la evolución y la estructura del Universo. Estos descubrimientos son algo que, evidentemente, fastidiarán mucho a los creyentes en el ateísmo, pues contradice la base de su fe, pero el ateismo es algo que es puramente una pura creencia basada unicamente en la fe, mientras que la existencia de Dios se ve respaldada por miles de nuevos descubrimientos, desde la fragilidad de la estructura del Universo tras el Big Bang hasta la red neuronal que hace posible la consciencia. El avance de la ciencia hace cierta lo que dijo Pascal “un poco de ciencia aleja de Dios, pero mucha ciencia lleva directamente a Dios”. De esta forma, un poco de ciencia fue usado en el siglo pasado por los ateos para atacar la conclusión de la existencia de Dios, pero el avance de la ciencia ha dado la razon al final a quienes defendian la existencia de Dios como la unica solucion que permitia resolver la ecuacion del Universo, y eso es algo que los creyentes en el ateismo no han podido soportar. Asi que se han dedicado a atacar a la ciencia, formando una especie de nueva inquisición atea, en una divertida, pero terrible, inversión del papel.

    Es decir, los ateos han defendido la ciencia mientras les ha servido para defender su creencia. En el momento en el que la ciencia ha descubierto indicios primero y pruebas fehacientes de la existencia de una entidad diseñadora en el universo, tal y como predijo Pascal,
    los ateos han arremetido contra la ciencia, llegando al punto actual en el que inician una caza de brujas contra cualquier laboratorio, centro de investigación o descubrimiento cientifico que descubra nuevos indicios de que vivimos en un universo diseñado y ordenado, en lugar de en el universo caotico y absurdo en el que ellos pretenden desesperadamente que vivimos.

    La razon por la que la unica respuesta logica es que Dios existe es que en el universo se cumplen reglas fisicas, pero tambien, a veces, se rompen esas mismas reglas fisicas, y no solamente eso, sino que las leyes parece que estan hechas para proteger y asegurar nuestra supervivencia como especie y, ademas, la ruptura de esas leyes se produce justo cuando la aplicacion de esas leyes acabaria con nosotros como especie.

    Eso es comparable a ganar una vez la loteria con un solo numero y decir que ha sido por suerte. A ganarla tambien el año siguiente y decir que ha sido una casualidad increible, y a ganar la loteria durante mil quinientos años seguidos, todos los años, con solo un numero. ¿Que se dice entonces? El ateo dira que sigue siendo cuestion de suerte. Una persona honrada y sincera reconocerá que, por huevos, el sorteo ha tenido que estar amañado.

    Hasta ahora solo sabiamos el resultado de dos o tres loterias y los ateos afirmaban que era cuestion de suerte. La ciencia ahora nos permite conocer la historia del Universo desde hace millones de años, con lo cual, al saber el resultado de sorteos desde hace millones de años, ven invalidados sus argumentos, y se tienen que limitar a defender posturas tan ridiculas como que llevamos ganando todos los sorteos de probabilidad fisica del Universo desde hace millones de años con tal de no reconocer que su prejuicios estaban equivocados.

    Un ejemplo (solo uno) de los millones de sorteos que hemos ganado, o de las rupturas de las leyes fisicas es el equilibrio materia – antimateria. La astrofisica ha descubierto que, tras el Big Bang, una inmensa cantidad de materia y de antimateria se creo, perfectamente equilibrada. En teoría, toda la antimateria tendría que haber anulado a su vez a la parte contraria, y al reves, pero en la practica, contra todas las leyes fisicas, en una fracción de la materia no se aplicó esto y ese es el origen del universo tal y como lo conocemos. Asi pues es fisicamente imposible que estemos hoy aquí. Si estamos es justamente porque se ha roto esa ley fisica y, como todo el mundo sabe, la naturaleza no rompe sus propias leyes arbitrariamente.

    Otro ejemplo de los innumerables ejemplos de “tocar la loteria siempre contra todas las leyes de la probabilidad” ocurrio hace 65 millones de años. En la lucha por la supervivencia, los grandes saurios habian ganado toda la carrera universal. Sus grandes dientes no necesitaban complicados cerebros y eran unos depredadores tan temibles que estaban en la cuspide de la cadena alimentaria. En esa situación, los pequeños mamiferos, con sus cerebros complejos y sus sistemas de sangre caliente, imprescindible para el nacimiento de cerebros mas complicados, jamas se hubieran desarrollado.

    Y que pasó justo entonces???? Un meteorito del tamaño del golfo de Mexico cayó en la Tierra, algo que jamás se había producido antes (desde que la Tierra tenia una atmosfera moderna que eliminaba los meteoritos), ni después, pues nos habría extinguido a nosotros. Y ese meteorito provocó un invierno nuclear lo suficientemente intenso como para matar a los dinosaurios con sus sistema de sangre fria, pero no lo suficientemente intenso como para matar a los mamiferos con sistemas de sangre caliente.

    Y la diferencia entre esos dos puntos es de 0,000003 % de la temperatura en el momento del impacto.

    La posibilidad de que con la caida de un meteorito del tamaño del Golfo de Mexico y trillones de toneladas se ajuste la temperatura del planeta hasta una precisión de 0,000003 % para que justamente los mamiferos pequeños podamos sobrevivir es practicamente de 0. Si eso no es que nos ha tocado la loteria de nuevo.

    Y, en cumplimiento de la Navaja de Occam que dice que en igualdad de condiciones, la explicación más sencilla es la más real, debemos aceptar, entonces, que hay una única elemento-entidad que ha diseñado el universo tan perfectamente creado y ajustado, antes que creer que se producen millones y millones de casualidades desde hace millones de años del Universo.

    NOTA: Esto es una defensa racional de la existencia de Dios, fuera de la creencia. Como dijo Pascal “Un poco de ciencia te aleja de Dios, pero mucha ciencia te lleva directamente a Dios”. Nótese que los creyentes en el ateísmo no son capaces de argumentar nada y en su lugar deben limitarse a estos sketches de humor crticando algo tan ridículo que nadie defiende, como es la materialidad de algo que por definición es inmaterial.”

    P.D: Sigo esoerando respuestas a mis preguntas científicas incluyo la respuesta a
    la pregunta sobre esa expresión físico-matemática cierta

  74. Sencillo dice:

    Coincidencias de las Constantes Universales

    Uno de los descubrimientos más notables de los últimos 30 años ha sido el reconocimiento de que los más mínimos cambios en cualquiera de las constantes universales produce dramáticos cambios en el universo, transformándolo en insoportable para la vida, no sólo de la vida normal que conocemos sino para cualquier tipo de vida concebible. Más de 100 ejemplos se han documentado en la literatura técnica, y han sido expuestos en libros tales como el the Anthropic Cosmological Principle (Barrow & Tipler 1986).

    Por ejemplo, si la fuerza fuerte con la que se mantienen unidas las partículas del núcleo atómico fueran sólo un 5% más débiles, únicamente sería estable el átomo de hidrógeno, entonces tendríamos un universo con una tabla periódica de un sólo elemento, lo que significa que ese universo sería incapaz de producir la complejidad molecular necesaria para producir las funciones mínimas que la vida necesita para generar energía, almacenar información, y replicarse. Por otra parte, si esta misma fuerza fuerte fuese sólo un 2% mayor, existirían posibilidades de que se formara núcleos muy masivos, lo cual son también inadecuados para el proceso químico de la vida, además no sería posible el hidrógeno estable, por lo tanto no habría algo tan vital como estrellas duraderas, ni siquiera existirían los compuestos de hidrogeno.

    Como segundo ejemplo, si la relación entre la fuerza fuerte y la fuerza electromagnética variase únicamente de manera leve (y no drástica como lo es), entonces no dispondríamos de los niveles de energía cuántica que nos permiten la conversión del berilio al carbono (de manera casi 100% eficiente) y la conversión parcial de carbono a oxigeno. Con ligeros cambios en cualquiera de estas constantes, alternativamente nos aparece un universo muy rico en berilio y escasisimo en carbono, o bien, un universo rico en oxigeno pero sin carbono en absoluto.

    Puesto que el carbono es único en sus posibilidades de combinaciones químicas con prácticamente cualquier otro elemento, mediante enlaces que son muy estables, pero que sin embargo no son difíciles de romper (jugando el crítico papel de reordenar las piezas en un juego más pequeño), es destacable que estas fuerzas están ajustadas de manera tan precisa para producir carbono en abundancia, al igual que el oxigeno que es crítico en s{i mismo.

    Se podrían añadir muchos otros ejemplos. Si arrojo un dado y sale un “6”, usted no debería asombrarse por ello. Si arrojo el dado cinco veces y en las cinco saco un “6”, entonces usted debería estar algo suspicaz. Sin embargo, si arrojo el dado mil veces y obtengo un “6” en todas ellas, usted tendría la certeza de que hay alguna trampa en el dado. Así es de caprichoso nuestro universo, en que cada característica que conviene a la vida que el universo posea, si la buscamos, nos damos cuenta de que la tiene. Hume y otros han dado argumentos incorrectos sobre que no es sorprendente que cada cosa sea así, de lo contrario no estaríamos aquí para notarlo. El bien conocido ateo J.L. Mackie (Miracle of Theism, p.141) vió el fallo en el argumento de Hume:

    Hay sólo un universo, con un único conjunto de materiales básicos y constantes físicas, y es sorprendente que los elementos de este único conjunto se auto-ajusten correctamente para la vida cuando fácilmente podrían haberlo hecho de forma incorrecta. Lo que no es menos sorprendente por el hecho de que si no hubiera sido así no estaríamos aquí para sorprendernos. Nosotros podemos claramente figurarnos otras posibilidades alternativas que no incluyan nuestro ser estando allí para experimentarlo.

    Sir Fred Hoyle, el famoso astrofísico británico, en The Intelligent Universe comentó en las coincidencias cosmológicas discutidas por Mackie, “Tales proteínas parecen circular a través de la fábrica del mundo natural como un hilo conductor de coincidencias felices. Pero hay tantas extrañas coincidencias esenciales para la vida que parece que requieren alguna explicación que las abarque a todas ellas”.

    “Ligeras variaciones en las leyes físicas de la gravedad o electromagnetísmo har{ian la vida imposible . . . la necesidad de producir vida está presente en el centro de toda la maquinaria y diseño del universo,” John Wheeler, Princeton University professor of physics (Reader”s Digest, Sept., 1986).

    Los astrónomos de la Universidad de Virginia R.T. Rood and J.S. Trefil concluyen su libro Are We Alone ? estimando la probabilidad de existir vida en cualquier lugar del universo como de una entre mil millones, y así concluyen que la existencia de vida en la Tierra, lejos de ser algo inevitable, es el resultado de un notable conjunto de coincidencias.

    “Si yo fuera un hombre religioso”, dice Trefil en en último capítulo, “diría que todo lo que hemos aprendido sobre la vida en los últimos veinte años nos muestra que somos especiales y únicos para el deseo de Dios”. En su lugar, Trefil concluye que la vida en nuestro planeta es un accidente muy destacable, siendo improbable que se hay producido otro igual en todo el universo, lo cual es el principal argumento de su libro.
    Condiciones Iniciales

    Los problemas de condiciones iniciales aparecen en muchas partes de nuestro escenario del origen del universo, su desarrollo en un confortable hogar para nosotros, y el origen de la vida. Estos problemas de condiciones iniciales, en realidad, se complican teniendo en cuenta que muchos procesos críticos en el escenario de los orígenes tienen un carácter no-lineal, y por lo tanto, requieren unas condiciones iniciales particularmente precisas. En el libro citado anteriormente, Trefil y Rood estudian detalladamente algunos ejemplos de este tipo. Yo también discutiré, brevemente, problemas de condiciones iniciales que están relacionados con el rigen del universo y con el origen de la vida.

    Resumiendo esta sección, está muy claro que parece haber algo único y especial con nuestro hogar en el universo y nuestra existencia en él.

  75. Sencillo dice:

    Condiciones Iniciales

    Los problemas de condiciones iniciales aparecen en muchas partes de nuestro escenario del origen del universo, su desarrollo en un confortable hogar para nosotros, y el origen de la vida. Estos problemas de condiciones iniciales, en realidad, se complican teniendo en cuenta que muchos procesos críticos en el escenario de los orígenes tienen un carácter no-lineal, y por lo tanto, requieren unas condiciones iniciales particularmente precisas. En el libro citado anteriormente, Trefil y Rood estudian detalladamente algunos ejemplos de este tipo. Yo también discutiré, brevemente, problemas de condiciones iniciales que est{an relacionados con el rigen del universo y con el origen de la vida.

    Resumiendo esta sección, está muy claro que parece haber algo único y especial con nuestro hogar en el universo y nuestra existencia en él.
    Origen del Universo

    La Cosmología no es neutral cuando se enfrenta a la Filosofía y a la Teología. Un universo que hubiera existido eternamente es mucho más agradable para una visión ateísta o agnóstica del mundo. Puesto que un universo con comienzo parece necesitar de una primera causa; ¿ quién podría imaginar un efecto tal como ese sin una causa suficiente ?.

    En un dramático artículo en el American Association for the Advancement of Science de 1977, Robert Jastrow, profesor de la Universidad de Columbia y director del Goddard Space Center, hizo una presentación que más tarde sería publicada en un libro titulado God and the Astronomers. En esta presentación, Jastrow, que se considera agnóstico, indicaba que las evidencias para la cosmología del Big Bang han superado al resto de las cosmologías desde 1929, pero que muchos científicos han rehusado aceptarla debido a que no les satisface sus implicaciones filosóficas.

    Por ejemplo, Sir Arthur Eddington cuando se encontraba comentando el Big Bang en los años 1950, hizo la siguiente indicación: “Desde el punto de vista de la Filosofía, la noción de un comienzo del orden presente de la Naturaleza es una noción repugnante . . . a mí me gustaría encontrarme con una escapatoria más genuina”.

    En la década de los años 1970, tras el descubrimiento en 1965 de la radiación de fondo (N.T.: radiación remanente de micro-ondas), John Gribbin dijo en Nature,

    El mayor problema con la teoría del Big Bang es filosófica –puede que incluso sea teológica–, es lo de ¿ qué es lo que había antes del “Bang” ?. Este problema únicamente fue suficiente para dar un gran ímpetu a la teoría del “Steady State”; pero con esta teoría que en estos momentos se encuentra en permanente conflicto con las observaciones, la mejor manera de evitarnos estas dificultades iniciales es un modelo en que el universo se expande desde una singularidad, después vuelve a colapsar, y así vuelve a repetirse el ciclo indefinidamente.

    [Unos artículos publicados en 1984 por Guth y Bludman en la revista Nature en 1984 demuestran la imposibilidad de un universo “oscilante” de esta manera.]

    Jastrow llegó a declarar que ya era la hora de que los astrónomos comiencen a reconocer las implicaciones filosóficas de sus descubrimientos . Jastrow concluyó su presentación con el comentario, “Para el científico que ha vivido con su fe en el poder de la razón, la historia [del big bang] termina como una pesadilla. Durante los últimos trescientos años, los científicos han estado escalando la montaña de la ignorancia, y cuando ellos se encontraban llegando a la roca final, se han dado cuenta que una banda de teólogos estaban sentados allí sentados desde hace siglos”.

    Es más, recientes medidas realizadas por el satélite Cosmic Background Explorer (COBE) y por el Hubble Space Telescope, ambos en 1992, parecen confirmar más allá de la duda razonable que la cosmología de Big Bang es realmente correcta. George Smoot, profesor de la Universidad de California en Berkeley y principal investigador del equipo COBE que realiz{o el descubrimiento, tras estudiar los datos de las observaciones dijo: “Lo que parece que hemos encontrado es evidencias del nacimiento de universo . . . es como observar las huellas de Dios”.

    “La comunidad científica está preparada para considerar que la idea de Dios creador del Universo es una hipótesis más respetable hoy que en cualquier tiempo de los últimos 100 años”, según declaró el historiador de la ciencia Frederic B. Burnham.

    No descubrimos nada si decimos que el libro de Stephen Hawking Una Breve Historia del Tiempo tiene el propósito de intentar escapar a las implicaciones del Big Bang, contra las que el autor hace objeciones filosóficas, pero no científicas. El libro está lleno de conjeturas no enraizadas en la ciencia observacional y no debería tomarse como una ciencia cuidadosa sino como argumentos polémicos motivados por sus propias creencias “religiosas”. El hecho por el que Stephen Hawking se vio obligado a escribir este libro indica la fuerza del Big Bang en los argumentos de un universo teista.
    La Teoría de Información y el Origen de la Vida

    Las funciones mínimas necesarias para la vida requieren una gran complejidad molecular : procesamiento de energía, almacenamiento de información, y todo el proceso de reproducción. La evolución química, que es diferente de la evolución biológica, no puede hacer uso de la mutación y de la selección natural para resolver sus problemas (que por cierto tampoco resuelven la macroevolución).

    La evolución química es la responsable del desarrollo de los sistemas vivientes partiendo de una sopa prebiótica que inicialmente no poseía moléculas, y mucho menos sistemas con capacidad de reproducirse. La producción de moléculas tales como proteínas, ARN y ADN procedentes de una sopa prebiótica es extremadamente difícil de imaginar. La euforia original asociada con la producción artificial de aminoácidos a base de condiciones prebióticas, tal como fue realizada por Stanley Miller en 1952, ha sido reemplazada por un sombrío reconocimiento que el verdadero problema es el ensamblamiento de tales moléculas en funciones biopolímeras. Un problema es análogo a la extracción de letras de una caja al azar con la esperanza de conseguir accidentalmente una secuencia que corresponde a palabras, frases y párrafos completos.

    Como Sir Fred Hoyle sugirió en The Intelligent Universe “El escenario actual del origen de la vida es algo así como si un tornado pasara por la chatarrería de la compañía aérea de Los Boeing y construyera accidentalmente una avión 747”.

    En un artículo del Scientific American (February, 1991), Sir Francis Crick indicó “El origen de la vida parece ser un milagro, así son tantas las condiciones que deberían haberse cumplido para que esto ocurriera”.

    En este mismo artículo, Harold Klein que presidió el comité de la Academia Nacional de Ciencias que revisó el origen de la vida indicó: “La bacteria más simple es tan condenadamente complicada para un químico que es prácticamente imposible imaginar como se formó”.

    Quién crea que los trabajos recientes sobre el ARN serán capaces de resolver el problema del origen de la vida debería leer el artículo de Robert Shapiro sobre Origins of Life and Evolution of the Biosphere (1988) o el artículo de Klaus Dose en Interdisciplinary Science Reviews (1988) titulado “Origin of Life: More Questions than Answers.”

  76. sbas dice:


    El Dr. Benjamin Mann del DARPA, junto a sus homólogos, estarán llorando ante tus planteamientos.
    Lo vuestro es como buscarle el final a una banda de Moebius y pretender además haber demostrado su segunda cara con ecuaciones.

    Cuando tengo la calculadora al revés y pulso la tecla del 9 me aparece un 6, ¿es eso normal o tengo que llevarla al técnico?

  77. Manuel Abeledo dice:

    Ello, por tanto, implica que el ADN –un mensaje– es fruto de una concepción inteligente

    Esto implicaría que toda organización espontánea ha sido creada por una inteligencia superior. ¿Los cristales de sal son creados por una inteligencia superior?

    Vamos, vamos, no os exalteis. La evolución es un hecho y descartarla sería como negar que la Tierra tiene un campo gravitatorio.

  78. sbas dice:

    Por cierto SENCILLAMENTE deja de pegar, como tuyas, parrafadas extraidas de sitios poco reomendables o aunque lo fuesen. Nos pones el enlace y ya veremos La anterior en concreto es de la serisima “conoze.com”. Si tienes opinión propia, dudos en un cerebro como el tuyo, dála y si no CALLATÉ que diria un buen porteño.

  79. sbas dice:

    El Post anterior va para mister sencillo

  80. Sencillo dice:

    Sr sebas usted solo dice chorradas, NO PRUEBA NADA, NO CIENCIA , NO PUEBAS.
    LE CITO:

    El Dr. Benjamin Mann del DARPA, junto a sus homólogos, estarán llorando ante tus planteamientos.
    Lo vuestro es como buscarle el final a una banda de Moebius y pretender además haber demostrado su segunda cara con ecuaciones.

    Cuando tengo la calculadora al revés y pulso la tecla del 9 me aparece un 6, ¿es eso normal o tengo que llevarla al técnico?”

    ¿Pero de que chorradas habla usted?: de calculadoras al revés y pulsaciones de teclas y bla, bla. Que incoherencias son estas, NO ACLARAN NADA DE NADA. PUROS BALBUCEOS SIN ARGUMENTOS
    ¿Que tiene esto que ver con las preguntas que he realizado y de la demostración de
    la inexistencia de dios de forma científica?

    Y en cuanto a esta otra estupidez:
    “Lo vuestro es como buscarle el final a una banda de Moebius y pretender además haber demostrado su segunda cara con ecuaciones.”
    Le respondo con esto:
    Cuando responda a esta pregunta podremos seguir hablando. Tampoco usted responde a las preguntas científicas que he realizado. NO PUEDEN PROBAR, SOLO VERBORREA BARATA, FILOSOFÍA PUERIL, NO CIENCIA, NO PRUEBAS.
    Al grano, la expresión matemática: 32 X ( Masa Planck )^2/ tan A = ( Masa Tierra )^2

    Donde tan A = tangente curvatura espacio-tiempo producida por una masa igual a la del electrón y a una distancia igual al radio terrestre ecuatorial.

    Le aligeraré el trabajo: tang x en función de la masa y la distancia, SEGÚN LA TEORÍA DE LA RELATIVIDAD GENERAL ES: tan x = ( 4 x M x Gn )/ ( c^2 x d ) ;
    donde M = masa , Gn = constante gravitación Newton, c = velocidad luz en el vacio y
    d = distancia.
    ¿SABE USTED CUAL ES LA PROBABILIAD DE QUE ESA EXPRESIÓN FÍSICO-MATEMÁTICA SEA CASUAL?. Pues con un cálculo muy sencillo de probabilidades se demuestra rápidamente que es como mínimo de 1/( 2E60 ) ; es decir: que probabilísticamente se considera probabilidad 0; ( 1/(2E60) =4,7E-61 )
    La demostración es bien simple: si usted considera solo el rango de masas que existen en el universo y restrigiendolo, es decir limitándolo, al intervalo que varia desde la masa del Sol ( 1,9 E31 ) hasta la masa del electrón ( 9,1 E-31 ); entonces se tiene que para la expresión CIERTA, QUE SE CUMPLE, ANTERIORMENTE DADA, TENEMOS UN RANGO DE MASAS A ELEGIR EN ESA EXPRESIÓN DE 2E60, Y POR LO TANTO QUE JUSTAMENTE SOLO Y SOLAMENTE SI PONEMOS JUSTO LA MASA DE LA TIERRA OBTENEMOS JUSTAMENTE Y CON EXACTITUD LA PARTE IZQUIERDA CUANDO SOLO Y JUSTAMENTE SE CALCULA CON EL RADIO ECUATORIAL TERRESTRE; LA PROBABILIDAD MATEMÁTICA ES DE 4,7E-61 DEBIDO AL AZAR, ES DECIR SE PUEDE CONSIDERAR 0.
    OSEA NO ES CASUAL. AHORA RESPONDA QUE SIGNIFICA LA NO CASUALIDAD DE ESA EXPRESIÓN Y déjese de respuestas no científicas y chorrescas sobre calculadoras puestas al revés y demás memeces

  81. GAC dice:

    Manuel Abeledo

    Hola amigo, le he encontrado en otras webs debatiendo sobre evolucionismo contra el creacionismo veo que su interes por este tipo de debates viene de largo.

    Yo no pretendía resultar fanático ni muchos menos probar el infierno y todas las mentiras del vaticano. Aun siendo el infierno un estado del alma real despues de haber rechazado a Dios con los actos de la vida (que eso ya es cuestión de fé) yo pretendía y pretendo probar que la evolución es una farsa. No digo que no haya cambios en los seres vivos porque es evidente que los hay.

    Lo que digo es que la evolución.. , que de esos pequeños cambios surjan unas especies de otras.. de un pez un elefante.. lo siento.. es tan absurdo y la evidencia científica y sobre todo fosil tan pobre… que afirmarlo me parece faltar a la verdad.

    En primer lugar cabe hablar del papel del azar en la evolución. Lo primero que se puede decir es que responsabilizar al azar como elemento fundamental de la evolución no es una explicación científica. Los grados de orden existentes en los terrenos micro y macroscópicos son tan complejos y maravillosos que atribuir estas configuraciones al azar es renunciar a ejercitar la razón. Nadie niega la existencia de cierto azar en la vida pero creer en el azar como motor de la evolución requiere una fe irracional en el azar.

    Las famosas teorías del evolucionismo de Darwin se basan en los principios de adaptación al medio y selección natural. Tales principios quedan muy limitados y puestos en entredicho por varios logros científicos. Mendel, en la segunda mitad del siglo XIX, demostró que los caracteres adquiridos en la vida no se transmiten por herencia. En el siglo XX el descubrimiento del código genético en el ADN puso de manifiesto que existe un alto grado de determinación molecular, inscrito en las diversas especies, que acota mucho las posibilidades de una evolución.

    Existen nuevas versiones del darwinismo que han intentado hacerlo compatible con la genética. Una es la teoría sintética de la evolución. Esta hipótesis habla de una sucesión de pequeños cambios debidos a mutaciones aleatorias. El azar sigue aquí presidiendo la evolución.

    Los macroevolucionistas hablan, por el contrario, de saltos cualitativos considerables en algunos momentos de la evolución. Por ejemplo: la aparición de los ojos, el paso de peces a reptiles, el pulmón de los anfibios.

    La última palabra quizá la tenga en estos momentos la biología molecular, para la que cada vez resulta más evidente que las diferencias entre las especies tienen mucho más que ver con la determinación molecular de su DNA que con los principios expuestos por Darwin. Contra el neoevolucionismo, que basa todos los cambios en el azar, se abre paso cada vez más el concepto de programa evolutivo: la existencia de una finalidad en la evolución dependiente del ADN de cada especie.

    Otras son las posturas creacionistas que consideran que cada cambio que surge en el universo se debe a una acción directa de la causa creadora. Esto supondría negar la cierta autonomía de las leyes de la materia, cosa que no parece razonable. Sin embargo cabe plantear una excepción: el espíritu humano; ya que posee inteligencia y voluntad. Estas capacidades no se pueden reducir a mera biología de modo semejante a como no se puede reducir la música a sus mecanismos de transmisión. Aquí si parece correcto considerar una intervención directa de la causa creadora en el surgimiento del programa de vida de cada ser humano; esto es: en la concepción. Si alguien dijera que esto es ciencia ficción cabría responderle si no hará él una ciencia de la ficción haciendo a la materia responsable de la novena sinfonía de Beethoven.

  82. Sencillo dice:

    ¿Es usted fascista sr sebas, e intolerante. USTED NO ES NADIE PARA MANDARME CALLAR, ENTENDIDO,MUCHACHITO?
    Menos humos
    Pongo el enlace que efectivamente se me olvido
    sbas Dice:
    Agosto 13, 2008 a las 9:54 am

    Por cierto SENCILLAMENTE deja de pegar, como tuyas, parrafadas extraidas de sitios poco reomendables o aunque lo fuesen. Nos pones el enlace y ya veremos La anterior en concreto es de la serisima “conoze.com”. Si tienes opinión propia, dudos en un cerebro como el tuyo, dála y si no CALLATÉ que diria un buen porteño.

    Sencillo Dice:
    Agosto 13, 2008 a las 10:01 am

    Sr sebas usted solo dice chorradas, NO PRUEBA NADA, NO CIENCIA , NO PUEBAS.
    LE CITO:

    El Dr. Benjamin Mann del DARPA, junto a sus homólogos, estarán llorando ante tus planteamientos.
    Lo vuestro es como buscarle el final a una banda de Moebius y pretender además haber demostrado su segunda cara con ecuaciones.

    Cuando tengo la calculadora al revés y pulso la tecla del 9 me aparece un 6, ¿es eso normal o tengo que llevarla al técnico?”

    ¿Pero de que chorradas habla usted?: de calculadoras al revés y pulsaciones de teclas y bla, bla. Que incoherencias son estas, NO ACLARAN NADA DE NADA. PUROS BALBUCEOS SIN ARGUMENTOS
    ¿Que tiene esto que ver con las preguntas que he realizado y de la demostración de
    la inexistencia de dios de forma científica?

    Y en cuanto a esta otra estupidez:
    “Lo vuestro es como buscarle el final a una banda de Moebius y pretender además haber demostrado su segunda cara con ecuaciones.”
    Le respondo con esto:
    Cuando responda a esta pregunta podremos seguir hablando. Tampoco usted responde a las preguntas científicas que he realizado. NO PUEDEN PROBAR, SOLO VERBORREA BARATA, FILOSOFÍA PUERIL, NO CIENCIA, NO PRUEBAS.
    Al grano, la expresión matemática: 32 X ( Masa Planck )^2/ tan A = ( Masa Tierra )^2

    Donde tan A = tangente curvatura espacio-tiempo producida por una masa igual a la del electrón y a una distancia igual al radio terrestre ecuatorial.

    Le aligeraré el trabajo: tang x en función de la masa y la distancia, SEGÚN LA TEORÍA DE LA RELATIVIDAD GENERAL ES: tan x = ( 4 x M x Gn )/ ( c^2 x d ) ;
    donde M = masa , Gn = constante gravitación Newton, c = velocidad luz en el vacio y
    d = distancia.
    ¿SABE USTED CUAL ES LA PROBABILIAD DE QUE ESA EXPRESIÓN FÍSICO-MATEMÁTICA SEA CASUAL?. Pues con un cálculo muy sencillo de probabilidades se demuestra rápidamente que es como mínimo de 1/( 2E60 ) ; es decir: que probabilísticamente se considera probabilidad 0; ( 1/(2E60) =4,7E-61 )
    La demostración es bien simple: si usted considera solo el rango de masas que existen en el universo y restrigiendolo, es decir limitándolo, al intervalo que varia desde la masa del Sol ( 1,9 E31 ) hasta la masa del electrón ( 9,1 E-31 ); entonces se tiene que para la expresión CIERTA, QUE SE CUMPLE, ANTERIORMENTE DADA, TENEMOS UN RANGO DE MASAS A ELEGIR EN ESA EXPRESIÓN DE 2E60, Y POR LO TANTO QUE JUSTAMENTE SOLO Y SOLAMENTE SI PONEMOS JUSTO LA MASA DE LA TIERRA OBTENEMOS JUSTAMENTE Y CON EXACTITUD LA PARTE IZQUIERDA CUANDO SOLO Y JUSTAMENTE SE CALCULA CON EL RADIO ECUATORIAL TERRESTRE; LA PROBABILIDAD MATEMÁTICA ES DE 4,7E-61 DEBIDO AL AZAR, ES DECIR SE PUEDE CONSIDERAR 0.
    OSEA NO ES CASUAL. AHORA RESPONDA QUE SIGNIFICA LA NO CASUALIDAD DE ESA EXPRESIÓN Y déjese de respuestas no científicas y chorrescas sobre calculadoras puestas al revés y demás memeces

  83. GAC dice:

    De todas formas no se preocupen la verdad es muy tozuda y al final sale a la luz.. Aquí tienen otra noticia clara del centro de investigaciones en genética humana de Sidney.

    El británico Michael Denton, biólogo molecular, director del centro de investigaciones en genética humana de Sidney, en Australia, ha afirmado en París que la búsqueda de los famosos eslabones perdidos en la evolución de los seres vivos ha fracasado porque no han existido jamás, en contra de la teoría sostenida por Darwin.

    En el curso de una conferencia organizada en la universidad de la Sorbona por la asociación francesa HIT (siglas en francés de Alta Tecnología de Inteligencia), el biólogo Michael Danton ha expuesto las razones que le han conducido a atacar a su ilustre predecesor: “Darwin fue víctima de una paradoja. En efecto, hace más de un siglo propuso una teoría que se enfrentaba a los dogmas del creacionismo. Con el paso del tiempo su teoría se ha transformado, ella misma, en un dogma al que se prohíbe cuestionar, so pena de ser tratado como antievolucionista”.”Nadie niega”, insiste, “los principios de la evolución de los organismos vivos por modificación del genoma (material hereditario). La selección natural puede estar en la base de ciertas transformaciones a nivel de especie, pero es absolutamente insuficiente para brindar una explicación global de la evolución”.

    Danton rechaza la idea de una evolución “de pasos pequeños”, que transformaría, por ejemplo, a un mamífero terrestre en una ballena con una multitud de modificaciones necesarias y tan importantes como la modificación de sus miembros ariteriores hasta convertirse en aletas.

    Si esta hipótesis fuera correcta debían de haber existido miles de especies de transición que habrían dejado algún rastro en nuestros días, según Denton, pero nada de eso se ha encontrado. Los saltos en la evolución han sido constatados por numerosos investigadores que trabajan sobre distintas especies pero Denton denuncia que un secretismo profesional ha ocultado estos descubrimientos porque cuestionan la teoría oficial, basada exclusívamente en datos morfológicos.

    Nuevas herramientas
    Los recientes descubrimientos de la biología molecular han puesto a disposición de los científicos unas herramientas completamente nuevas que permiten comparar los organismos según los criterios bioquímicos. Así es como se ha podido descubrir entre otros el Opposum, considerado como un marsupial primitivo, que no presenta las características bioquímícas que deberían corresponder a los ancestros de su grupo.Lo mismo ocurre con el Dipneusto, extraño pez de los mares africanos que puede respirar indístintamente por branquias o pulmones y cuya figura correspondería al eslabón perdido entre los animales acuáticos y terrestres pero que sobre el plano molecular no presenta ningún indicio del carácter de transición que se le supone.

    En su conferencia -como en su libro Evolución, una teoría en crisis- Michael Danton no busca establecer nuevas teorías infalibles. Se limita a proponercuestiones que se desprenden de los últimos descubrimientos cientíricos.

    Una cosa es segura, concluye, haciendo una comparación inesperada: la evolución de los seres vivos sigue una lógica similar a la de la historia de los relojes. Los primeros aparatos mecánicos, los digitales y los atómicos, lo único que tienen en común es que miden el tiempo. En las diferentes categorías, han evolucionado poco a poco, pero para pasar de una fase de la evolución esencial a otra han dado saltos cualitativos gracias a la adorición de tecnologías completamente.

  84. Manuel Abeledo dice:

    Lo que digo es que la evolución.. , que de esos pequeños cambios surjan unas especies de otras.. de un pez un elefante.. lo siento.. es tan absurdo y la evidencia científica y sobre todo fosil tan pobre… que afirmarlo me parece faltar a la verdad.

    Tú tienes una opinión. Los biólogos, bioquímicos y demás científicos tienen la evidencia. Como supongo que tú no tienes conocimientos de biología más allá de lo que lees en los enlaces que has proporcionado, ¿cómo pretendes sentar cátedra acerca de lo que es o deja de ser absurdo?

    Nadie niega la existencia de cierto azar en la vida pero creer en el azar como motor de la evolución requiere una fe irracional en el azar.

    La fe siempre es irracional. De todos modos, el azar no es el motor de la evolución sino el origen de ciertos mecanismos que dan lugar a la selección natural. Aunque no lo parezca son dos cosas muy, muy diferentes.

    [..] la aparición de los ojos, el paso de peces a reptiles, el pulmón de los anfibios.

    Estos son los puntales creacionistas más conocidos 🙂

    Los ojos no han aparecido “de repente”, y existe una línea evolutiva muy clara sobre este órgano, cuyos ancestros fueron células fotosensibles. Desde esta perspectiva, el conjunto de cientos de miles de esas células, cada una de las cuales especializada en la detección de unos pocos tonos, es un ojo.

    El paso de peces a reptiles tampoco tiene lagunas. El problema, amigo, es que te has saltado los anfibios de los que hablas más adelante. Todavía hoy podemos ver anfibios con branquias y pulmones primitivos y los análisis de ADN confirman su relación con especies de peces y reptiles.

    Sobre el espíritu y demás no voy a discutir, simplemente no creo que exista causalidad en las leyes del Universo y me parece una postura de lo más retrógrada, semejante a la de los antiguos que consideraban toda desgracia como “un castigo de dios”.

  85. sbas dice:

    NO me llamo sebas.
    Jope, ¡qué facil sacar de casillas a un exaltado fanático! pegas y pegas lo mismo una y otra vez.
    ¿En cuanto al significado de la expresión, debería decirle?: ¡oh si papa. tenés razón , sos grande! Tan absurdo como aceptar que existe dios porque existen los ateos sin aquel esos imposible. ¿cierto?

  86. Sencillo dice:

    Sigo esperando respuesta a la pregunta que le hice y usted se dedica a marear la perdiz, POR QUE NO SABE RESPONDER y vuelve a incurrir en discurso balbuceantes no científicos, sin pruebas sobre no se que tonterías y estupideces sobre papa y mama que no vienen al caso.
    Yo pruebo, usted solo dice chorradas y cosas que no aportan pruebas.

  87. Sencillo dice:

    Estimado contertulio sr Manuel Abeledo Dice: ” Sobre el espíritu y demás no voy a discutir, simplemente no creo que exista causalidad en las leyes del Universo y me parece una postura de lo más retrógrada,”

    VAYA ESTUPIDEZ MÁS ILÓGICA, SE LA CITO EN GRANDE: “simplemente no creo que exista causalidad en las leyes del Universo ”

  88. Manuel Abeledo dice:

    Sencillo, con “causalidad” me refiero a un origen primero y único. Pero gracias por remarcarlo, porque tampoco creo que las leyes del Universo tengan una finalidad.

    Y no comiences con “estimado” si luego te comportas como un energúmeno.

  89. Magufo dice:

    Aqui hay alguien que aun no ha entendido la diferenciua entre el hecho de la evolucion y su mecanismo.

    Cuando citais a Darwin estais hablando de su mecanismo y la verdad, no vais a poder refutar el hecho de la evolucion intentando desmontar su mecanismo, es asi de facil.

    Imagina un relampago. Por una parte tenemos el hecho del relampago y por otra la explicacion fisica de porque y como surge el relampago. ¿dejaria de existir el relampago si nos equivocaramos explicandolo?

    ¿dejaria de exisitir la gravedad si la teoria de newton y de eistein estuviera equivocaca?
    ¿Dejaria el viento si la teoria que explica su funcionamiento fuera erronea?

    Y la buena…¿Porque pretendeis que la evolucion deje de exisitir cuando lo unico que haceis es intentar destruir sus posibles mecanismos? ¿Que esperais demostrar atacando al neodarwinismo? Como mucho refutareis el neodarwinismo, pero la evolucion seguira ahi…

    Como dije..informaos un poquito desde webs serias y prestigiosas porque luego os armais un lio impresionante. LLevais dias haciendo el ridiculo, es como si pretendierais hacer creer a los demas que la lluvia no existe por el simple hecho que no sabemos como funciona..

    ¿dejaran de evolucionar los seres vivos si el mecanismo de darwin esta equivocado? evidentemente NO..

    Hay que saber distinguir entre la explicacion y lo que queremos explciar, y en esas paginas crisitianas no parece que tengan muy clara la diferencia, ¿habeis probado con un libro de evolucion? ¿o un libro a secas?

    Fosiles transicionales? Puedo llenar tu casa de fosiles transicionales..Vamos que seguiis la evolucion se va modernizando y adaptando a nuevos tiempos mientras vosotros seguiis criticandola con los mismos argumentos de hace un siglo..¿are you from the past?

    Aunque los fosiles transicionales tampoco es que tengan gran valor para probar el hecho de la evolucion, los fosiles de transicion tienen valor para apoyar a Darwin…y si no hubiera fosiles de transicion…oh que pena..la evolucion seguiria existiendo porque el registro fosil la apoya con otros innumerables restos fosiles..

    Ale, a leer un poco

  90. Heli dice:

    Sencillo yo no soy científico difícilmente le podría platicar sobre sus preguntas. Claro que usted tampoco es científico así que lo único que haríamos es seguir engordando el diálogo de besugos que estamos llevando en el hilo. Si quiere desmontar la teoría sintética de la evolución, el único camino honesto es hacer ciencia con los científicos. Conviértase en científico, publique en revistas especializadas, hágase notar haciendo buenos experimentos y construyendo teorías sólidas. No se desmonta una ciencia tratando de convencer a los legos sobre su falsedad, se desmonta haciendo ciencia. Ahora mismo lo que esta haciendo usted es política, propaganda, esta tratando de convencer a unos internautas a base de pegar mogollón de textos de dudosa procedencia. Básicamente nos esta predicando, y así lo único que puede conseguir es gente convencida de sus ideas, pero no demostrara científicamente la validez de sus argumentos.

  91. airf0il dice:

    Y dura, y dura…

  92. airf0il dice:

    Realmente, esto es tal y como había pensado.

    Sólo tengo una cosa que decir a los creyentes exaltados. No pruebas dios existir. Pruebas evolución ser real.

    Se entiende? Gracias.

  93. Mulder dice:

    …y todo para no admitir que “los chemtrails no existen”, y querer hacernos quedar mal como sea, aunque tengamos que acudir a Dios o al incomprensible origen de todo…

    Son las cosas del fundamentalismo…

  94. Hola Sencillo.

    En respuesta a su comentario que dice:

    “En teoría, toda la antimateria tendría que haber anulado a su vez a la parte contraria, y al reves, pero en la practica, contra todas las leyes fisicas, en una fracción de la materia no se aplicó esto y ese es el origen del universo tal y como lo conocemos.”

    Le indico que eso no es correcto. La materia y la antimateria no se comportan exactamente igual:

    Y respecto a este otro:

    “La posibilidad de que con la caida de un meteorito del tamaño del Golfo de Mexico y trillones de toneladas se ajuste la temperatura del planeta hasta una precisión de 0,000003 % para que justamente los mamiferos pequeños podamos sobrevivir es practicamente de 0. Si eso no es que nos ha tocado la loteria de nuevo.”

    En realidad:
    1) No está claro que fuera un meteorito lo que acabó con los dinosaurios o bien ya estaban en decadencia.
    2) No está claro que fuera ese meteorito el que acabó con los dinosaurios o bien otro que habría caído unos 300.000 años más tarde (según algunos).
    3) El meteorito que usted menciona era bastante más pequeño (unos 10 Km de diámetro).
    4) Caen meteoritos con bastante más frecuencia de la que usted menciona (vea
    5) ¿Puede decir dónde ha extraido el dato del 0’000003%?

    Y finalmente, le comento que no es posible saber qué había antes del Big Bang ya que del tiempo “0” al “10E-45” nos encontramos en el “Tiempo de Planck”, donde las leyes de la física conocida pierden validez. Por lo tanto no es posible saber qué sucede en ese intervalo de tiempo y menos aún qué sucedió antes (si es que hubo un antes). Eso sí, conjeturas tendrá todas las que quiera 😉

    Un saludo

  95. Magufo dice:

    Vamos, que a estas alturas aun haya gente que niegue el hecho de la evolución…es como para hacerselo mirar.

    Pero bueno, no es tan extraño, de hecho aun hay gente que piensa que la tierra es plana.

  96. Avalon dice:

    La religión puede ser un producto tóxico,pero el materialismo puede ser herína pura.El producto humano que está en estos momentos dirigiendo el mundo,al verse desconectado del sentido de la transcendecia,no sabe donde anclar valores tales como la dignidad,¿dónde se ancla?.Hablan mucho de la ética laica,bien,pero la ética laica sin un sentido de transcendencia es,ami juicio.tremendamente frágil.

  97. Manuel Abeledo dice:

    la ética laica sin un sentido de transcendencia es,ami juicio.tremendamente frágil.
    Explícanos por qué.

  98. airf0il dice:

    Cualquier persona civilizada y en sus cabales tiene un sentido de la ética bien formado, y unos valores morales bien establecidos.

  99. Avalon dice:

    La eternidad existe,nosotros aqui estamos muy de paso.Hay algunos que creen que estamos sin ningún sentido y otros que creen que su gran tarea es averiguar el sentido de la existencia.Esa es una idea que se ha ido poniendo en marcha apartir del triunfo del materialismo y el racionalismo,que ahora se están encontrado con problemas muy serios y son incapaces de encontrar donde está la materia última,A medida que profundizan en la física cuántica se alejan de la materia para encontrar un vacío.Es un vacío que esta lleno de lo que nosotros llamamos espiritu,El sentido de la existencia,por qué estamos aquí,es absolutamente capital.

  100. Manuel Abeledo dice:

    Primero, haz el favor de demostrar que existe la eternidad.

    No voy a explicar nada sobre la teoría cuántica porque hablar de ella en términos de “vacío” es, como poco, atrevido. Pero sí diré algo sobre el sentido de la existencia: no hay sentido. Somos lo que somos no porque haya un plan supremo para cada uno, sino por nuestra herencia y nuestras vidas. No hay finalidad en la vida más allá de la que uno quiera darle, como tampoco hay finalidad en las leyes naturales. La gravedad simplemente es, la evolución simplemente es, y cada uno de nosotros es.

    Buscar razones fundamentales o últimas para darle importancia a la existencia es, bajo mi punto de vista, bastante patético. Y no me malinterpretes, no quiero insultarte, pero pensar que hay gente que necesita darle sentido a su vida creyendo en un más allá, en un ser supremo, en el destino o en cualquier otra cosa me inspira lástima.

  101. Sencillo dice:

    Tengo que contestarle sr. Heli:

    “Heli Dice:
    Agosto 13, 2008 a las 2:13 pm

    Sencillo yo no soy científico difícilmente le podría platicar sobre sus preguntas. Claro que usted tampoco es científico así que lo único que haríamos es seguir engordando el diálogo de besugos que estamos llevando en el hilo. Si quiere desmontar la teoría sintética de la evolución, el único camino honesto es hacer ciencia con los científicos. Conviértase en científico, publique en revistas especializadas, hágase notar haciendo buenos experimentos y construyendo teorías sólidas. No se desmonta una ciencia tratando de convencer a los legos sobre su falsedad, se desmonta haciendo ciencia. Ahora mismo lo que esta haciendo usted es política, propaganda, esta tratando de convencer a unos internautas a base de pegar mogollón de textos de dudosa procedencia. Básicamente nos esta predicando, y así lo único que puede conseguir es gente convencida de sus ideas, pero no demostrara científicamente la validez de sus argumentos.”

    1) Soy científico. ¿Porqué es tan presuntuoso de hablar de lo que soy, si no sabe de mi absolutamente nada?. Sea más prudente.
    2) Yo solo he pegado un texto, el de conze.com
    La expresión matemática INCONTROVERTIBLE ESFRUTO DE MI INVESTIGACIÓN, ¿queda ya clarito?. Y eso de dudosa procedencia, olvídese.

  102. Sencillo dice:

    Para usted:
    Manuel Abeledo Dice:
    Agosto 13, 2008 a las 11:35 am

    Sencillo, con “causalidad” me refiero a un origen primero y único. Pero gracias por remarcarlo, porque tampoco creo que las leyes del Universo tengan una finalidad.

    Y no comiences con “estimado” si luego te comportas como un energúmeno.

    ¿Porque me insulta, llamándome energúmeno?
    Yo no le he insultado
    Lo que le he dicho,parte , es esto: “VAYA ESTUPIDEZ MÁS ILÓGICA,”
    Decir que”vaya estupidez más ilógica” no es un insulto, ni ser un energúmeno

  103. Manuel Abeledo dice:

    Sencillo, me vas a permitir que te conteste.

    1. ¿Qué clase de científico eres?
    2. Aunque la ecuación propuesta fuese cierta, de ella no se deduce que su origen sea una causa última, un dios o un origen inteligente.
    3. Partes de que no crees que una expresión sea casual para inferir que no es casual. ¿De veras que eso es ciencia? Tu razonamiento tiene la misma validez que éste: yo creo que dios no existe porque no puedo imaginar que permita el sufrimiento de la Humanidad. El error está en la creencia.
    4. Dudo que un científico aplique un razonamiento tan pueril y fácilmente desmontable como el tuyo, pero no me voy a meter en el tema. Me basta con saber a qué disciplina te dedicas.

  104. Manuel Abeledo dice:

    Sobre tu última respuesta te diré que sí, te has comportado como un energúmeno al decir que un razonamiento perfectamente válido es una “estupidez ilógica”.

  105. Manuel Abeledo dice:

    Y una última cosa, ¿podrías exponer el cálculo detallado de esa fórmula? Curiosamente no consigo obtener el mismo resultado que tú. Quizá me haya equivocado en algo.

  106. Sencillo dice:

    Ese razonamiento suyo: el decir que las leyes del universo no tienen causa es una aberración y repito ,estupidez, descomunal.
    Y cualquier científico honrado se lo diría igual de claro.
    Porque si hablamos con una lógica tan pobre, endeble E ILÓGICA, por la mima regla de tres tan simploide puedo afirmar, por ejemplo esto: LOS COCIENTES ENTRE LAS MASAS DE LAS DE LAS DIFERENTES PARTÍCULAS ELEMENTALES NO TIENEN CAUSA Y ME QUEDO TAN PANCHO. No me haga reir
    Y en cuanto a esto:
    “1. ¿Qué clase de científico eres?
    2. Aunque la ecuación propuesta fuese cierta, de ella no se deduce que su origen sea una causa última, un dios o un origen inteligente.”
    Eso lo dice usted que no se deriva esa inferencia, lo dice usted, PERO NO LO DEMUESTRA QUE NO SE INFIERE, no demuestra, nada. Segumos con el bla, bla, vació de demostraciones rigurosas
    Y en cuanto a que disciplina me dedico, que dice que lo sabe usted, dígamelo y le confirmaré si es así o no.
    Llama usted pueril a una expresión físico-matemática, ¿PUERIL DICE?, pues vaya para usted debe de ser pueril la formula de Stirling, por ejemplo, o también debe de ser pueril la expresión matemática de la relatividad general para calcular el ángulo de desviación que sufre un rayo de luz al pasar, por poner un caso, cerca del Sol.
    En definitiva, parece que para usted todos las demostraciones y leyes físico-matemáticas deben de ser pueriles. Estudie matemáticas y física, se lo recomiendo, al menos cuando hable conmigo de estos temas, de los cuales sufre usted una carencia educacional abismal, según lo que demuestra al hablar en términos tan profános, pero sin un mínimo nivel elemental

  107. Manuel Abeledo dice:

    Ese razonamiento suyo: el decir que las leyes del universo no tienen causa es una aberración y repito ,estupidez, descomunal.

    ¿Afirmas pues que existe una especie de causa “inteligente” de las leyes del Universo o incluso una finalidad?

    Eso lo dice usted que no se deriva esa inferencia, lo dice usted, PERO NO LO DEMUESTRA QUE NO SE INFIERE, no demuestra, nada. Segumos con el bla, bla, vació de demostraciones rigurosas

    Disculpa pero la carga de la prueba recae en quien realiza una afirmación. Si de veras crees que de una fórmula matemática que relaciona varias constantes se puede deducir que existe un ordenador único y universal, demuéstralo. La fórmula por si misma no demuestra absolutamente nada y la inferencia es producto de tu opinión personal.

    Llama usted pueril a una expresión físico-matemática, ¿PUERIL DICE?,

    El razonamiento posterior es pueril, no la ecuación.

    Estudie matemáticas y física, se lo recomiendo, al menos cuando hable conmigo de estos temas, de los cuales sufre usted una carencia educacional abismal, según lo que demuestra al hablar en términos tan profános, pero sin un mínimo nivel elemental

    Soy ingeniero y te puedo asegurar que sé lo suficiente sobre física y matemáticas como para defenderme, gracias. Esto, unido a mi afición por la lectura de ensayos científicos, te impiden siquiera ofenderme lo más mínimo con semejantes afirmaciones, sobre todo teniendo en cuenta el cúmulo de errores de bulto y la falta absoluta de rigurosidad de tu disertación.

    Reitero mi curiosidad sobre la ecuación, pues no obtengo igualdad alguna si sigo tus instrucciones, e incluso dudo ligeramente que el uso de las magnitudes sea correcto. En fin, otro día será, yo me voy a dormir 🙂

  108. Avalon dice:

    nos tenemos que dar cuenta,que no es que mueran 5000 niños,es que los estamos matando.No hay nada absolutamente en el mundo de lo que no seamos responsables.No hay un tema de otros que no sea de nosotros.Occidente se ha desentendido…Simplemente, con que asumierámos que todas esas cosas están pasando porque estamos consitiendo que pasen,el mundo cambiaría.Pero nos han enseñado a que yo soy yo y los otros son los otros,mis actos no tienen nada que ver con los actos de los otros….esto es falso,fisíca,economica,cultural y socialmente.

  109. Simple dice:

    A ver con esta trampa si puedo responderle señor Manuel Abeledo



    Hola, hola,


    “Manuel Abeledo Dice:
    Agosto 13, 2008 a las 8:46 pm

    Y una última cosa, ¿podrías exponer el cálculo detallado de esa fórmula? Curiosamente no consigo obtener el mismo resultado que tú. Quizá me haya equivocado en algo.”

    Sí te voy a poner el cálculo detallado, reordenando la expresión para que calcules más fácil

    Se cumple que, reordenando ( pasando termino que multiplica, dividiendo, etc ):

    8x ( Masa de Planck/ masa del electrón ) x Energía de Planck ( Masa Planck x C^2 ) =

    ( ( Masa Tierra )^2 x Gn ( constante gravitatoria newton ) ) / ( Radio terrestre ecuatorial )





    Masa de la Tierra= 5,9736 E24 Kg

    Radio terrestre ecuatorial = 6378100 m

    Masa de Planck = 2,17644 E-8 Kg

    Masa del electrón = 9,10938125 E-31 kg

    Constante gravitación Newton = 6,67428 E-11 m^-3 kg^-1 s^-2

    velocidad de la luz = 2,99792458 E8 m/s



  110. Sr. Sencillo:

    Sobre su expresión matemática: 32 X ( Masa Planck )^2/ tan A = ( Masa Tierra )^2

    Bueno, he hecho los cálculos y sí que salen las cuentas. En ambos lados queda 3’6·10^49 Kg^2.

    No obstante eso no significa nada en particular. Una fórmula física Como decía un profesor mío “con veinte constantes yo ajusto un elefante”. Y realmente lo hacía, con una bonita combinación de constantes era capaz de obtener la catedral de Milán, por poner un ejemplo.


    La pregunta es irrelevante ya que usted ha creado la fórmula a su antojo. Con otras partículas, otras distancias, otras constantes y otro numerito delante en vez del 32 podríamos obtener resultados similares.

    Además, el cálculo de probabilidades que usted realiza no es que sea sencillo, es que es erróneo. No se basa en ninguna ley estadística conocida.

    Un saludo

  111. Simple dice:

    “Reitero mi curiosidad sobre la ecuación, pues no obtengo igualdad alguna si sigo tus instrucciones, e incluso dudo ligeramente que el uso de las magnitudes sea correcto.”

    Pues no se que calculadora usa usted, ni que clase de ingeniero será. Pero este cálculo
    tan sencillo y que no lo pueda obtener me da que pensar sobre sus capacidades matemáticas y no digamos de física.

  112. Avalon dice:

    no voy a explicar nada sobre la eternidad,siguiendo tu sugerencia,Manuel Abeledo.Goethe dijo “Me preguntas qué es los justo;te diré:lo que conviene a quien lo aplica”.La conveniencia como principal motor de la convivencia es terrible,acaba con todo.

  113. Simple dice:

    “La pregunta es irrelevante ya que usted ha creado la fórmula a su antojo. Con otras partículas, otras distancias, otras constantes y otro numerito delante en vez del 32 podríamos obtener resultados similares.”


    1/( 2 E60 ) = 5 E-61, practicamentete igual a 0

    ¿Usted sabe realmente algo de probabilidades?, ¿ DE VERAS?, pues no señor, usted no sabe probabilidades, ni las básicas.
    Y el anterior razonamiento es válido para el rango de masas que ya explique y no me molestare a repetir todo el argumento matemático incontrovertible y demostrado y DEMOSTRABLE

  114. Sr. Simple:

    Pasaré por alto su comentario sobre que no sé de probabilidades…

    Si es tan amable de exponer de dónde ha deducido su expresión tal vez nos entengamos mejor.

    Un saludo

  115. airf0il dice:

    “1/( 2 E60 ) = 5 E-61, practicamentete igual a 0”

    Supongo que como científico sabrá que no hay números “prácticamente iguales a 0”, como números “prácticamente iguales a infinito”.

  116. Simple dice:

    No, amigo la deducción NO LA PUBLICARÉ JAMÁS, NI TAMPOCO LA EXPONDRÉ PARA USTED , por que aún haciéndolo NO QUERRÍA VER LA VERDAD.
    Para que me voy a molestar. Ya tiene usted una información suficiente, si realmente busca usted LA VERDAD, despojada de todo condicionamiento, adoctrinamiento, etc, ya me entiende usted Sr Pedro Enguita ,ALLÍ TIENE ESTO.
    Y sí, tengo la deducción y tanto que la tengo.
    Esta sociedad basada en el actual sistema de valores toca a su fin.
    Llegará el día que incluso mi deducción será de risa en comparación con las maravillas
    que le esperan a LA AUTENTICA HUMANIDAD.
    Saludo cordialmente a todos los interlocutores con los que he tenido el placer de intercambiar puntos de vista y con esto me despido y finalizo mi intervención en este blog.
    Les deseo todo lo mejor, de corazón

  117. Pues nada, Señor Sincero. Una lástima que no se avenga a publicarla, así saldríamos de dudas. Un placer y hasta otra 😀

  118. Perdón, quería decir Señor Simple.

  119. GAC dice:

    Sinceramente al que me dijo lo de que yo no soy biólogo .. le diré que me parece que ninguno de los que estamos aquí tenemos conocimientos mucho mas allá de lo que podemos leer … Es decir que nadie habla con la evidencia de sus propias investigaciones científicas… sencillamente porque que yo sepa nadie aquí es ni arqueólogo ni trabaja con un grupo de “evolucionistas” buscando pruebas de la evolución.

    Por eso… a las pruebas contundentes que les presento y a mis conocimientos sobre todo en los campos de la informática y las matemáticas.. les diré..

    Que no sea mecánico no quiere decir que no sepa reconocer a un buen mecánico cuando lo veo.. Que no sea futbolista no quiere decir que no distinga el buen jugador en un partido por la tele del que no lo es.. etc..

    Por eso.. afirmo..

    Habeis mentido tanto en este blog sobre los variopintos temas que aquí se han tratado que ya pierdo la cuenta. Me parece bien que decidáis ser fanáticos de Hawkins a la hora de mostrar ese fundamentalismo ateo que tanto miedo os dá que sea desbancado por vuestra amada ciencia..

    Pero os diré .. la ciencia va mas de la mano de la evidencia de un creador, de la evidencia de Dios que lo contrario..

    Si no lo quereis ver no es mi problema..

    Solo un necio niega la existencia del agua cuando se encuentra sumergido en ella..

    Si tan claro teneis vuestra fé atea.. me podríais responder al dilema de las profecías cumplidas de la biblia para vosotros?.. Como es posible?.. Alguien puede refutar eso desde la lógica..?.

    No , ¿verdad?..

    Podeis refutar desde la lógica la fé de mas del 88% de la humanidad en Dios y los efectos que tiene sobre todos estos creyentes directamente cada día?.. Creando conciencias a prueba de bombas contra el propio mundo..

    La fé no se demuestra, se experimenta.. no me cansaré de decirlo.. pero para no venir a rezar a vuestro blog solo diré.

    Hay pruebas de la existencia de Dios por mucho que os moleste y tambien diré.. la teoría de la evolución es una farsa ya desmontada..

    Los hay que se agarran al clavo ardiendo todavía.. claro que sí.. porque no pueden soportar en sus arrogantes y ateas mentes la idea de que hayan estado equivocados tanto tiempo.. y sobre todo la idea de Dios.. sobre lo cual probablemente les haría cuestionarse la forma en la que han vivido buena parte de sus vidas y seguro.. no lo soportarían.

    Con evolución no hay Dios por tanto podemos hacer lo que nos de la gana.. no hay consecuencias de nuestros actos ni castigo por nuestros pecados.. Si aparece Dios… muchos se acojonarán porque quizá ahi empiezen a pensar en lavar su conciencia por lo que pueda pasar despues de su muerte..


    Sencillo, SIMPLE.. no te esfuerces mas de lo debido porque alguna de esta gente son fundamentalistas de sus ideas y jamás verán mas allá de ellas.. Es perder el tiempo y el tiempo es demasiado valioso como para desperdiciarlo intentando como dicen por ahi pellizcar el cristal de la ignorancia..

    Llegado su debido tiempo todos conoceremos la verdad de todas esas preguntas milenarias que aquí planteamos.. y seguro que muchos pasarán un mal trago al haber ignorado lo que era tan evidente….

  120. airf0il dice:

    GAC, repito. Hay pruebas de la teoría de la evolución, y si no tuviera bases ya no sería considerada teoría. Por el contrario el creacionismo no tiene ni una prueba, ni sigue ningún razonamiento lógico.

  121. Magufo dice:

    “Sinceramente al que me dijo lo de que yo no soy biólogo .. le diré que me parece que ninguno de los que estamos aquí tenemos conocimientos mucho mas allá de lo que podemos leer”

    Es que yo sí soy biologo y como bien dice tengo los conocimientos que me proporciona la lectura, solo que como biologo seguramente leere más cantidad de documentos de esta disciplina que un no biologo. Tampoco he querido decirlo antes porque no hace falta, lo que importa es el contenido de los comentarios, no por ser biologo voy a tener mas razón que usted.

    “la teoría de la evolución es una farsa ya desmontada..”

    Que yo sepa quien la desmonto ni ha recibido el nobel ni ha sido santificado..¿esta usted seguro?

  122. Magufo dice:

    Por cierto airf0il, naufragando por la red buscando cosas de ateismo relacionadas con tu post y alguno que va apareciendo por meneame, encontre un blog cojonudo sobre ateismo, muy ironico y cachondo, no puedo parar de reirme.

    Es el blog de Dios, sisi, ahora Dios tambien tiene un blog y desde alli nos explica su propia vision del mundo. Os enlazo a uno que seguro le gustara mucho a GAC

    “la visceral necesidad de mi existencia”

    “Acerca de los continuos debates sobre mi existencia tengo que decir que evidentemente existo porque la mayor parte de la gente tiene la necesidad visceral de creer en mí.

    – Soy una respuesta simple y fácil para explicar todo lo que no se entiende, evitando perder tiempo en la búsqueda de complicadas explicaciones.
    – Soy una idea muy reconfortante porque alimento el ego humano diciendo que sois las criaturas más importantes del universo y que yo, su creador, os ama.
    – Soy una excelente forma de que las personas logréis una trascendencia que es la que os garantiza vuestra inmortalidad. De esta forma se os aplaca el pánico a que vuestra existencia no tenga más valor que la del resto de criaturas vivas o inertes y el, más terrible aún, pánico a la muerte. La vida eterna es, por supuesto, gozosa.”

  123. airf0il dice:

    Acabo de ver el blog, la verdad es que sólo con el nombre y el título ves de qué va la cosa ;).

    Curioso es que aún no haya recivido ataques. O quizás los creyentes creen que realmente es dios…misterios del universo.

  124. Manuel Abeledo dice:

    Al final nadie quiere demostrar que la eternidad existe, ni que su ecuación es correcta, ni siquiera que de toda su parrafada se puede deducir algo más que lo evidente: sólo quien tiene fe puede creer que existe un ser superior causa última de todo.

    No sé, me parece tan ridículo…

  125. Heli dice:

    Sencillo Fritz Lang o Ed Wood dibujaron científicos más creíbles, pero eso si, muy parecidos a usted. Tampoco le voy a decir yo como tiene que definirse. Pero si se considera científico razón de más para hacerme caso e invertir su tiempo en un debate verdaderamente fructífero con científicos. Pero bueno si le motiva más convencer a cuatro diablos en un foro, como mínimo tenga la prudencia y el sentido común de adaptar su discurso a los que no son especialistas en matemáticas o en física.

  126. El Creador dice:

    Me alegro profundamente de que en los debates sobre mi existencia siempre haya gente cuyos razonamientos estén convenientemente encauzados por su necesidad de creer en Mí y por el adoctrinamiento recibido. Es más, de no ser así, podrían llegarse a considerar de la misma enjundia que los debates sobre la existencia de los pitufos.
    Yo también me extraño de la falta de ataques en mi blog y espero gustoso la visita de descreídos a los que devolver al rebaño.

  127. Magufo dice:

    Creo que aqui va a encontrar varias ovejas descarriadas señor Creador, aunque dudo que volvamos a su rebaño debido que no tenemos una visceral necesidad de su existencia y seguramente tampoco hemos sido adoctrinados desde nuestra infancia para anular el maligno poder de la razon.


  128. ovo dice:

    Si, amigo, me parece muy bien tus ataques a los apocalipticos y conspiranoicos.
    Yo no me considero asi, pero he visto cosas ayer y te invito a que veas mi blog.

    No afirmo nada , simplemente presento fotos. Me gustaria que tu tambien aportaras evidencias.
    Como un contrail comienza o finaliza con un punto tan definido?


  129. ovo dice:

    Si, amigo, me parece muy bien tus ataques a los apocalipticos y conspiranoicos.
    Yo no me considero asi, pero he visto cosas ayer y te invito a que veas mi blog.

    No afirmo nada , simplemente presento fotos. Me gustaria que tu tambien aportaras evidencias.
    Como un contrail comienza o finaliza con un punto tan definido?



  130. airf0il dice:

    Ahora me paso por tu blog y te doy mi opinión.

  131. airf0il dice:

    Las tres primeras fotografías corresponden a contrails persistentes, en la tecera se aprecia como uno termina abruptamente, suele pasar cuando hay vientos en las alturas, o el avión ha descendido en ese punto.

    Las fotografías de nubes iridiscentes son curiosas pero no dejan de ser esto, nubes iridiscentes. Las formas curiosas, lo mismo.

    Por cierto, es posible que la franja nubosa de la última foto sea paralela al mar?

  132. Leien dice:

    Bueno, os dejo aquí una carta de un socialista y lo que pensaba de la educación religiosa. También aprovecho para opinar que sencillo y GAC, en este debate tan apasionante, han expuesto mejor talante y más argumentación que la otra parte que insulta mucho, saludos.

    la carta

    «Querido hijo, me pides un justificativo que te exima de cursar la religión, un poco por tener la gloria de proceder de distinta manera que la mayor parte de los condiscípulos, y temo que también un poco para parecer digno hijo de un hombre que no tiene convicciones religiosas. Este justificativo, querido hijo, no te lo envío ni te lo enviaré jamás.

    No es porque desee que seas clerical, a pesar de que no hay en esto ningún peligro, ni lo hay tampoco en que profeses las creencias que te expondrá el profesor. Cuándo tengas la edad suficiente para juzgar, serás completamente libre; pero, tengo empeño decidido en que tu instrucción y tu educación sean completas, y no lo serían sin un estudio serio de la religión.

    Te parecerá extraño este lenguaje después de haber oído tan bellas declaraciones sobre esta cuestión; son, hijo mío, declaraciones buenas para arrastrar a algunos, pero que están en pugna con el más elemental buen sentido. ¿Cómo sería completa tu instrucción sin un conocimiento suficiente de las cuestiones religiosas sobre las cuales todo el mundo discute? ¿Quisieras tú, por ignorancia voluntaria, no poder decir una palabra sobre estos asuntos sin exponerte a soltar un disparate?.

    Dejemos a un lado la política y las discusiones, y veamos lo que se refiere a los conocimientos indispensables que debe tener un hombre de cierta posición. Estudias mitología para comprender la historia y la civilización de los griegos y de los romanos, y ¿qué comprenderías de la historia de Europa y del mundo entero después de Jesucristo, sin conocer la religión, que cambió la faz del mundo y produjo una nueva civilización?.

    En el arte, ¿qué serán para ti las obras maestras de la Edad Media y de los tiempos modernos, si no conoces el motivo que las ha inspirado y las ideas religiosas que ellas contienen?. En las letras, ¿puedes dejar de conocer no sólo a Bossuet, Fenelón, Lacordaire, De Maistre, Veuillot y tantos otros que se ocuparon exclusivamente en cuestiones religiosas, sino también a Corneille, Racine, Hugo, en una palabra a todos estos grandes maestros que debieron al cristianismo sus más bellas inspiraciones?.

    Si se trata de derecho, de filosofía o de moral, ¿puedes ignorar la expresión más clara del Derecho Natural, la
    filosofía más extendida, la moral más sabia y más universal?—éste es el pensamiento de Juan Jacobo Rousseau.—

    Hasta en las ciencias naturales y matemáticas encontrarás la religión: Pascal y Newton eran cristianos fervientes; Ampère era piadoso; Pasteur probaba la existencia de Dios y decía haber recobrado por la ciencia la fe de un bretón;
    Flammarion se entrega a fantasías teológicas. ¿Querrás tú condenarte a saltar páginas en todas tus lecturas y en todos tus estudios?

    Hay que confesarlo: la religión está íntimamente unida a todas las manifestaciones de la inteligencia humana; es la base de la civilización, y es ponerse fuera del mundo intelectual y condenarse a una manifiesta inferioridad el no querer conocer una ciencia que han estudiado y que poseen en nuestros días tantas inteligencias preclaras.

    Ya que hablo de educación: para ser un joven bien educado, es preciso conocer y practicar las leyes de la Iglesia? Sólo te diré lo siguiente: nada hay que reprochar a los que las practican fielmente, y con mucha frecuencia hay que llorar por los que no las toman en cuenta. No fijándome sino en la cortesía, en el simple «savoir vivre», hay que convenir en la necesidad de conocer las convicciones y los sentimientos de las personas religiosas. Si no estamos obligados a imitarlas, debemos, por lo menos, comprenderlas, para poder guardarles el respeto, las consideraciones y la tolerancia que les son debidas. Nadie será jamás delicado, fino, ni siquiera presentable sin nociones religiosas.

    Querido hijo: convéncete de lo que te digo: muchos tienen interés en que los demás desconozcan la religión, pero todo el mundo desea conocerla. En cuanto a la libertad de conciencia y otras cosas análogas, eso es vana palabrería que rechazan de consuno los hechos y el sentido común. Muchos anti-católicos conocen por lo menos medianamente la religión; otros han recibido educación religiosa; su conducta prueba que han conservado toda su libertad.

    Además, no es preciso ser un genio para comprender que sólo son verdaderamente libres de no ser cristianos los que tienen facultad para serlo, pues, en caso contrario, la ignorancia les obliga a la irreligión. La cosa es muy clara: la libertad, exige la facultad de poder obrar en sentido contrario.

    Te sorprenderá esta carta, pero precisa, hijo mío, que un padre diga siempre la verdad a su hijo. Ningún compromiso podría excusarme de esa obligación”.

  133. airf0il dice:

    Leien, no olvidemos que para aceptar la religión hay que dejar de lado el razonamiento y la lógica. Y todo progreso humano ha sido fruto de la lógica y el razonamiento.

  134. manuelabeledo dice:

    No es lo mismo conocer la religión que ser religioso. En la mayoría de las ocasiones, conocer los ritos, dogmas y creencias de una religión deriva en el ateísmo.

    Ahora, el creacionismo es la forma más refinada de irracionalidad. La fe es irracional y el creacionismo aúna la fe en lo absurdo con la negación de las evidencias científicas.

  135. El creacionismo sostiene que las cosas no se hacen a sí mismas.

    Lo cual es una afirmación científica, lógica y razonable. El Universo, la Vida y el Hombre no han llegado a existir espontáneamente y por tanto, son la obra de un Creador.

    El método científico nos proporciona un torrente constante de evidencias creacionistas. Ninguna evidencia obtenida según el método científico niega la creación, al contrario. todos los descubrimientos científicos, todas las leyes científicas conocidas, todos los fenómenos observados en la naturaleza, son testimonios claros de un Creador.

    • Manuel Abeledo dice:

      Un pequeño Goebbels entre nosotros, ¡qué ilusión!

      Sólo me gustaría apuntar que es cierto, ninguna evidencia descarta este concepto de creación, como tampoco descarta la existencia de dragones, unicornios o brujas voladoras. Esto es así porque la ciencia no se mete en la mitología y tampoco debería ocurrir al revés. A lo sumo, la ciencia construye modelos que descartan las explicaciones fantásticas de manera lateral.

      De todos modos, resulta gracioso ver cómo se acude a un sentido común mal entendido para justificar el creacionismo. Me pregunto si utilizarán el mismo método para explicar los fenómenos cuánticos…

  136. La prueba más evidente de que la evolución no tiene base científica es que para defenderla se recurre a ridiculizar o insultar a quien la pone en duda.

    El creacionismo, a diferencia de la evolución, insiste en estudiar la naturaleza con el método científico.

    Por ejemplo:
    El estudio científico de la vida, su complejidad irreductible, no nos lleva a concluir que la vida surgió por generación espontánea sino por una causa inteligente.

    La generación espontánea es uno de los mitos evolucionistas que la humanidad ha podido descartar gracias al método científico.

    Dime Manuel: Si la vida es el resultado de procesos naturales ¿ Cómo surgió la primera especie ? ¿Qué fenómeno natural causó la existencia de la vida?

    • indarki dice:

      Creacionismo.net dijo:
      “El estudio de la vida, su complejidad irreductible, no nos lleva a concluir que la vida surgió por la vida surgió por generación espontánea sino por causa inteligente”

      Vale, genial… Yo he tenido un problema congénito en un oído y ahora, por lo que ahora no oigo por él. Insisto en lo de congénito, es decir, que me salió de nacimiento y no tuvo nada que ver con ninguna enfermedad adquirido o accidente… ¿Yo qué soy? ¿Un defecto de fabricación? ¿El diseñador inteligente no fue tan inteligente conmigo? ¿Quiso hacerme una putada? ¿o es que hay un diseñador (inteligente) y un montador, que no lo es?

      Es un caso concreto, pero ¿qué me dices de las muelas del juicio… ¿es muy inteligente diseñarlas para que no sirvan para nada y sólo den problemas? ¿y del apéndiz, que tampoco sirve y que puede provocar aprendicitis?

      ¿Qué quieres que te diga? No sé si eres de esos que defienden el creacionismo por que creen en Dios… si es así, te diré que yo sí creo en Dios y me encaja más con Él evolucionismo que el creacionismo… y no soy el único: muchísimos teólogos no tienen ninguna duda al respecto.

    • Manuel Abeledo dice:

      El creacionismo, a diferencia de la evolución, insiste en estudiar la naturaleza con el método científico.

      Hilarante 😀

      Qué tendrá que ver la religión y una hipótesis cuyo fundador no supo defender, con la ciencia…

      Dime Manuel: Si la vida es el resultado de procesos naturales ¿ Cómo surgió la primera especie ? ¿Qué fenómeno natural causó la existencia de la vida?

      No lo sé. Pero tampoco me invento la respuesta acudiendo a un ser mitológico 🙂

      Sobre la aparición del ojo y el oído, te invito a que entres en esta web y busques. Con suerte aprenderás algo de biólogos de verdad.

  137. Indarki se queja de problemas de oído.

    Yo oigo bastante bien, pero soy miope.

    Indarki y yo descendemos de un antepasado común que gozaba de buena vista y buen oído pero en el proceso de trasmisión genética, al copiar las cadenas de ADN, a veces se producen errores (mutaciones) que hacen que la copia sea de menor calidad que el original.

    La cuestión es ¿De dónde salió el diseño original?

    El ojo y el oído son sistemas de una intrincada complejidad y sofisticación. Al estudiar su funcionamiento observamos maravillas de la ingeniería.
    ¿Cómo llegaron a existir?
    La evolución dice que surgieron por procesos naturales pero la lógica dice que un sistema con características inteligentes procede de un agente inteligente.

    • indarki dice:

      > La cuestión es ¿De dónde salió el diseño original?

      Ni si quiera tú lo sabes. Tu forma de razonar es “Como no lo sé, supongo algo”. Eso es una hipótesis, no una demostración.

      Por cierto, que no sepas explicar algo no quiere decir que sea inexplicable, sino que tú no la sabes explicar.

      Analizando la anatomía humana, al biología, se intuye que más que un diseño es una acumulación de parches… es decir, que concuerda más con la evolución que con un diseño inteligente.

      > (…) descendemos de un antepasado común que gozaba de buena vista (…)

      Es decir, que lo que estamos sufriendo es una “involución”, cada vez somos más defectuosos. Podría ser, pero en otro mundo, no en este: todas las evidencias arqueológicas apuntan que los ancestros eran menos “complejos” no más, menos “perfectos”, no más.

      Insisto, como hipótesis, es interesante y se podría montar una buena historia de ciencia/historia ficción con eso, pero la realidad es otra… y la realidad suele ser muy tozuda.

      > (…) Al estudiar su funcionamiento observamos maravillas de la ingeniería. ¿Cómo llegaron a existir?

      Dos cosas:
      Una, de eso trata la ciencia, de buscar explicaciones racionales y no conformarse con un “Alguien lo creó así”.
      Dos, estudiando esas maravillas te das cuenta que tienen muchos fallos de diseño… si no, no habría tantos miopes, por ejemplo.

      Insisto: la evolución es más compatible con Dios que el creacionismo o el diseño inteligente, así que puedes seguir creyendo en Dios, no te preocupes porque tus fundamentos morales no están en peligro.

  138. Cuando pregunto a Manuel sobre el origen de la vida él responde: “No lo sé”.
    Así evita reconocer que como todo buen evolucionista él creen el la generación espontánea.

    La respuesta no está en mitos anticientíficos (generación espontánea) sino en el estudio empírico de las características observables de la vida.

    La microbiología ha descubierto que la vida es, en esencia, información. Información genética escrita en un idioma muy preciso llamado código genético. Instrucciones escritas maravillosamente en el núcleo de la célula y que al ser ejecutadas forman un ser vivo.

    Ahora dime ¿Cuál es el origen de la información escrita?
    Y no respondas “no lo sé” porque todos sabemos que la piedra de Roseta, las tablillas cuneiformes y los jeroglíficos egipcios contiene información y por tanto fueron escritos por agentes inteligentes. ¿Cómo llegó a existir la información escrita registrada en el código genético de la célula?

  139. Estoy de acuerdo con indarki cuando, hablando de las maravillas de la ingeniería observadas por la biología dice “de eso trata la ciencia, de buscar explicaciones racionales”

    Al estudiar una nave especial y preguntarnos por su origen consideramos razonable que ésta haya sido el producto de la inteligencia. Es una explicación racional porque es imposible que una serie de sistemas tan sofisticados sea el resultado de un fenómeno natural.

    Pues bien, una bacteria es muchísimo más compleja y sofisticada que una nave especial.
    ¿Por qué en el caso de la bacteria afirmas que su origen es “una acumulación de parches”?
    ¿Por qué es razonable pensar que una cámara fotográfica fue ideada por una mente inteligente y el sistema de visión humana (millones de veces más sofisticado) es el resultado de procesos naturales?
    ¿Por qué es razonable pensar que el radar de un avión ha sido diseñado y el radar del murciélago no?

  140. Una serie de puntos:

    1) los evolucionistas no creen en la generación espontánea. Nadie usa ya ese concepto. El evolucionismo y la aparición de la vida son dos cosas diferentes, si bien se pueden llegar a ligar.

    2) la información es algo que existe en la naturaleza de por sí. Una piedra contiene una cantidad ingente de información, incluso con una simple muesca en un palo (repito: una sola) sería posible almacenar todo el conocimiento humano. En la evolución la información útil se transmite a los descendientes, la inútil (en principio) no ayuda a que se transmita a los descendientes. De ahí que nosotros tengamos tanta “información útil”.

    3) Existen abundantes páginas de internet donde usted puede buscar cómo se desarrollaron sistemas tan complejos como la vista o el oído (le digo que las busque porque es mucho más fácil verlo con dibujos que con una parrafada).

    4) el método científico no niega la existencia de un Creador, sólo dice que se deben buscar causas naturales para explicar las cosas. Si usted quiere ser creyente o ateo es algo personal sobre lo que la ciencia no tiene nada que alegar.



  141. Mi enhorabuena a Pedro Enguita por su aportación clara, lógica y precisa.
    Permítame, con todo el respeto del mundo, disentir:

    Pedro dice que “los evolucionistas no creen en la generación espontánea”.


    Todos los evolucionistas creen que la vida no procede de una causa extranatural y por tanto creen que procede de una causa natural.
    Darwin en su famosa carta de 1871 establece los principios fundamentales de la generación espontánea de la vida que luego elaboró Oparin y más tarde experimentó Miller.
    Darwin intentó explicar EL ORIGEN DE LAS ESPECIES por medios puramente naturales. Si todas las especies surgieron por fenómenos naturales entonces la primera especie también lo hizo así. El surgimiento de la primera especie viviente por mecanismos puramente naturales es, llámesele como se le llame, generación espontánea.
    Se estima que en la Tierra existe más de 10.000.000 de especies. Es hipócrita decir que la evolución se ocupa del origen 9.999.999. Es decir de todas las especies menos de la primera.
    Si quieres explicar el surgimiento de una especie por causas puramente naturales lo más lógico es que empieces por la primera, no por la última.

    Pedro dice que “la información es algo que existe en la naturaleza de por sí.”


    La información especificada, la que transmite significado codificado, la que vemos en los periódicos, en los programas de ordenador o en el ADN no existe en ningún lugar de la naturaleza. O si no cita un ejemplo de información codificada que transmita significado y que exista espontáneamente en la naturaleza.

    Pedro dice que in Internet hay dibujos que explican la formación de los sistemas de visión.

    ¿ Qué clase de prueba empírica es eso ? Un dibujo es el producto de la imaginación de un evolucionista no un hecho empírico. Es la expresión gráfica de una idea. También hay dibujos de Adán y Eva en el huerto del Edén y a nadie se le ocurre que eso pruebe nada. La ciencia parte del análisis de hechos observados según el método científico, los dibujos son expresiones de la hipótesis no pruebas científicas. La ciencia ha descubierto que los ojos se forman porque el ADN del individuo contiene millones de instrucciones escritas que al ser ejecutadas forman los órganos de visión. ¿Cómo surgió este conjunto de instrucciones ?
    Existen en Internet muchos dibujos que reconstruyen el hombre del Piltdown, pero no existe ni una sola evidencia científica de que existiera.

    Dice Pedro “Si usted quiere ser creyente o ateo es algo personal sobre lo que la ciencia no tiene nada que alegar.”


    La ciencia tiene mucho que decir sobre el mundo natural. La ciencia nos lleva a la verdad y las creencias no.
    El método científico usado correctamente nos lleva a descubrir que la Tierra no es el centro del universo y toda creencia que afirme lo contrario es mentira (Gracias Galileo).

    • Manuel Abeledo dice:

      Todos los evolucionistas creen que la vida no procede de una causa extranatural y por tanto creen que procede de una causa natural.

      Lo cual no tiene absolutamente nada que ver con la generación espontánea.

      Para tu información, una o varias reacciones químicas orgánicas complejas, entendiendo por química orgánica aquella basada en el carbono, pueden darse sin que haya vida. Y de hecho, la vida es reducible a reacciones químicas.

      Respecto a Darwin, no explicó el origen de la vida del mismo modo que Newton no explicó el origen de la gravedad, y aún sin haberlo hecho ha contribuido más a la ciencia que todos los creacionistas que pululan hoy en día por la Tierra.

      La información especificada, la que transmite significado codificado, la que vemos en los periódicos, en los programas de ordenador o en el ADN no existe en ningún lugar de la naturaleza. O si no cita un ejemplo de información codificada que transmita significado y que exista espontáneamente en la naturaleza.

      Éste es un error muy común. La información está en cualquier parte y todo contiene información. Tú confundes información con interpretación de dicha información, y desconoces los términos de la teoría de la información.

      Por ejemplo, una de las paradojas más famosas sobre la información es qué ocurre cuando algo entra en un agujero negro, ¿puede la información ser irrecuperable? La paradoja se refiere a cualquier objeto, no a algo que tú interpretes que tiene información.

      Un ejemplo típico de “ordenación” (quizá éste sea el término apropiado para ti) son los cristales minerales: la formación de cristales depende de la organización interna y las propiedades atómicas del mineral. Y supongo que no crees que los minerales estén “vivos”.

      La ciencia parte del análisis de hechos observados según el método científico, los dibujos son expresiones de la hipótesis no pruebas científicas. La ciencia ha descubierto que los ojos se forman porque el ADN del individuo contiene millones de instrucciones escritas que al ser ejecutadas forman los órganos de visión. ¿Cómo surgió este conjunto de instrucciones ?

      Bajo tu punto de vista, los agujeros negros no existen.

      Es decir, tenemos pruebas indirectas de su existencia. Sabemos que algunos irradian rayos X. Sabemos que crean vórtices de luz. Sabemos que a veces tienen compañeros que giran de manera acelerada a su alrededor. Pero nadie ha visto nunca uno.

      ¿Implica eso que no existan? No, porque precisamente tenemos evidencias.

      Es curioso cómo los creacionistas aceptan muchas teorías físicas con menor evidencia visible que la teoría de la evolución. En la evolución del ojo puede establecerse una línea estructural, donde las primeras células fotosensibles dieron lugar a organizaciones más complejas, capaces de distinguir formas o colores, aumentando la precisión, etcétera.

      Por cierto, si el ojo fue “creado”, me pregunto por qué su “creador” no lo ha hecho mejor. Y no sólo el ojo sino otros muchos órganos. Los creacionistas creeis que un ente supranatural se ha tomado la molestia de “crear” ciertos órganos. Implícitamente, esto supone que dicho ente sea un chapuzas.

      El método científico usado correctamente nos lleva a descubrir que la Tierra no es el centro del universo y toda creencia que afirme lo contrario es mentira (Gracias Galileo).

      Del mismo modo, cualquiera que apele a un mal entendido sentido común para evidenciar la creación, es un mentiroso. Volviendo a la física, ¿podrías explicar cómo encajaría tu argumento del sentido común en la mecánica cuántica?

      No puedes. Nadie puede. El sentido común es una construcción mental que poco o nada tiene que ver con la ciencia. La ciencia, como método, va mucho más allá.

      • indarki dice:

        Manuel dijo: “Por cierto, si el ojo fue creado, me pregunto por qué su creador no lo ha hecho mejor”

        Este es el argumento y la duda que había plantado a Creacionismo.net y su respuesta (revísala por si acaso la he malinterpretado), cuanto menos, sorprendente: fuimos creados perfectos y la ¿evolución? no ha ido incorporando defectos.

        ¿Influencia de ese postulado metafísico de “Lo más perfecto no puede salir de lo menos perfecto”?

        Cada vez que lo pienso, las Vías de Santo Tomás tienen menos sentido y compruebo que han hecho más daño a la divulgación científica.

      • Manuel Abeledo dice:

        No lo había visto, pero resulta un poco contradictorio afirmar que la teoría de la evolución es falsa y luego utilizarla para argumentar que “incorpora defectos”.

        Ahora debería explicarnos si puede verificar que los hebreos de hace 2.500 años veían mejor que nosotros, no tenían puntos ciegos o eran inmunes a las ilusiones ópticas.

  142. Apreciado “Creacionismo.net”, gracias por sus aportaciones. Repasando las cuestiones que plantea:

    1) “los evolucionistas no creen en la generación espontánea”.

    El término “generación espontánea” es algo que, básicamente, ya no se utiliza. Es bastante fácil ridiculizar algo utilizando terminología obsoleta. Nadie (al menos nadie que yo considere sensato) habla de “geólogos catastrofistas”, “astrónomos heliocentristas”, “médicos alópatas”, “químicos atomistas” o “matemáticos pitagóricos”… Si bien en el fondo las ideas pueden permanecer los avances científicos hacen que esas ideas se hayan transformado bastante.

    En un principio no se trató el origen de la vida dentro de la evolución (básicamente porque no se tenía la más remota idea de cómo podía haber surgido la vida). Debo recordarle, no obstante, que con el transcurso de los años varias de las hipótesis que hablan del origen de la vida parten de selección natural de medios abióticos.

    3) Cuando dice usted “nternet hay dibujos que explican la formación de los sistemas de visión. ¿ Qué clase de prueba empírica es eso ? ” No he dicho que sea una prueba científica. No confundamos “ciencia” con “divulgación científica”, sólo le he dicho que esa información está disponible por si usted quiere buscarla. Si quiere pruebas deberá recurrir a las revistas especializadas que para eso están. No son muy favorables al Creacionismo, por cierto.

    4) Sobre cómo surge la información codificada en realidad se trata simplemente de que en la naturaleza existe información. Si dicha información se puede transmitir será más fácil que se propague que no si no lo hace, se convierte así en “información útil”.

    5) Cuando dice usted “La ciencia tiene mucho que decir sobre el mundo natural.” Estoy completamente de acuerdo: del mundo natural. De aquello que no es accesible al método científico difícilmente puede decir nada.


  143. Pedro, francamente, sus respuestas son muy correctas.
    Si me permite quisiera ir más en detalle.

    “con el transcurso de los años varias de las hipótesis que hablan del origen de la vida parten de selección natural de medios abióticos.”

    ¿Hipótesis? …
    ¿Basadas en qué hechos observados concretamente?
    ¿En qué medio abiótico se ha observado la selección natural?
    En el medio abiótico no existe selección natural darwinista porque no existe diferenciación reproductiva.

    ¿Varias hipótesis?
    Eso no es una ventaja para los evolucionistas sino una desventaja.
    Supongamos que tenemos 5 hipótesis abiogenéticas sobre la mesa. Al estudiarlas vemos que cada una de ellas prueba que la otras 4 son imposibles. Es decir que por cada hipótesis tenemos 4 contrahipótesis. Ejemplo: La panspermia de Crick desautoriza el ARN-primero

    “Si quiere pruebas deberá recurrir a las revistas especializadas”

    ¿Revistas especializadas?
    La evolución es para los evolucionistas un hecho tan claro como la gravedad.
    ¿Tengo que ir a las revistas especializadas para encontrar evidencias empíricas de la gravedad?
    Los fundadores de la teoría sintética supieron escribir para el público. “El Origen de las Especies” es facilmente comprensible y es allí donde se expone la teoría.
    No le estoy pidiendo una explicación técnica sino el nombre de un hecho empírico, u observable, o constatable, o repetible experimentalmente. Algo concreto que conduzca a pensar a un observador neutral que la información surge por sí misma y que una sucesión de errores de copia produce más información.
    ¿Dónde se observa la aparición no inteligente de información codificada?

    “se trata simplemente de que en la naturaleza existe información.”

    Bien. Pues cite un ejemplo de información que existe en la naturaleza que, como el ADN, esté codificada que, como el ADN, transmita un contenido semántico y que no proceda de un agente inteligente.

    Mis respetos.

  144. Apreciado “Creacionismo”. Trataré de contestar sus interesantes aportaciones:


    Sí, hipótesis porque no han sido demostradas. Es posible que para poder probarlas haya que viajar a algún planeta recién formado y estudiarlo in situ, lo cual no va a suceder pasado mañana.

    “¿Basadas en qué hechos observados concretamente?”

    La panspermia se basa en la existencia de moléculas complejas en el espacio (lo más complejo que se ha llegado a detectar, que yo sepa, son aminoácidos), el hecho de que condiciones favorables a la vida (planetas, agua, etc.) no parecen difíciles de encontrar, el hecho de que el viaje de la vida por el espacio interplanetario es factible y el hecho de que ha habido bastante tiempo (unos 9000 millones de años) entre el origen del Universo y la formación de la Tierra.

    La autocatálisis es un hecho científico demostrado experimentalmente (no quiero decir con esto que se haya demostrado que la vida comenzara así).


    “¿En qué medio abiótico se ha observado la selección natural?”

    La autocatálisis es, de hecho, una selección natural rudimentaria.

    “¿Varias hipótesis? Eso no es una ventaja para los evolucionistas sino una desventaja.”

    En primer lugar, al existencia de varias hipótesis para explicar un hecho no es algo anómalo ni que dé miedo a los científicos. Tampoco lo es decir “no lo sé” (de hecho es una de las mejores forma de distinguir la ciencia de la pseudociencia).

    De todas formas, si se empeña, le recuerdo que hay varias “hipótesis” creacionistas: “creacionismo de la Tierra joven”, “creacionismo de la Tierra vieja”, “creacionismo cristiano”, “creacionismo islámico”…

    “Supongamos que tenemos 5 hipótesis abiogenéticas sobre la mesa. Al estudiarlas vemos que cada una de ellas prueba que la otras 4 son imposibles. Es decir que por cada hipótesis tenemos 4 contrahipótesis. Ejemplo: La panspermia de Crick desautoriza el ARN-primero”

    Bueno, la hipótesis de Burkhard Heim desautoriza el modelo estándar de partículas y nadie deduce por ello que exista un Creador. Repito: a la Ciencia no le da miedo decir “no estoy seguro”, por eso se investiga. Uno de los inconvenientes del Creacionismo es que en cuanto usted recurre a un Creador es capaz de justificar cualquier cosa.

    “No le estoy pidiendo una explicación técnica sino el nombre de un hecho empírico, u observable, o constatable, o repetible experimentalmente. Algo concreto que conduzca a pensar a un observador neutral que la información surge por sí misma y que una sucesión de errores de copia produce más información.”

    Seré conciso: la microevolución no es negada por nadie, ni siquiera por (casi todos) los creacionistas, y responde favorablemente a todas las cuestiones que usted plantea.

    “¿Dónde se observa la aparición no inteligente de información codificada?”

    Seré conciso de nuevo: la microevolución no es negada por nadie, ni siquiera por (casi todos) los creacionistas, y responde favorablemente a todas las cuestiones que usted plantea.

    “Bien. Pues cite un ejemplo de información que existe en la naturaleza que, como el ADN, esté codificada que, como el ADN, transmita un contenido semántico y que no proceda de un agente inteligente.”

    Lo que pide no es falsable. Me explico. Le presento dos secuencias de números:
    Pues bien:
    Ambas contienen información y codificada de la misma manera. Una de ellas tiene “contenido semántico” y la otra se ha generado al azar. Indique cuál es cuál.
    Como ve, su hipótesis no es falsable.

    Saludos cordiales

  145. ASAP dice:

    Creo que hay poco que añadir a los excelentes comentarios de Pedro Enguita.

    Si separamos el origen de la vida de las teorías evolucionistas (cuestiones distintas desde la perspectiva científica) no cabe duda que no puede haber acuerdo sobre lo primero, pero es también es indudable que la evolución no tiene porque ser necesariamente incompatible con las creencias religiosas.

    Desde mi punto de vista, el mayor punto de desencuentro parte del fundamento teleológico de cualquier religión, que presupone que todo lo existente debe necesariamente haber sido creado para un fin concreto por un ‘agente inteligente’ Mientras que a las religiones le interesan las cuestiones ontológicas, la ciencia navega más por el terreno de la epistemología.

    Materia, energía e información son componentes de cualquier sistema complejo, el estudio del mundo físico desde el punto de vista de la ciencia no requiere de la existencia de un creador ni de un objetivo final de la misma. Una estructura cristalina, por ejemplo, contiene información que responde a las propiedades fisico-químicas del material ¿ necesariamente ha de existir un agente inteligente que justifique el origen y objeto de su existencia ?


  146. Pedro, explícanos por favor cómo la autocatálisis crea información nueva.

    Antes de responder déjenme recapitular la discusión desde le principio…

    Todos los seres vivos se forman al ejecutarse una serie de órdenes que están previamente escritas en el núcleo de sus células.
    Las órdenes están escritas usando un “abecedario” de 4 letras G,C,A,T y consisten en varios MILES DE MILLONES de letras. ( GCATTTGCAATGGCAATCGTA )
    Para formar un ser vivo, nuestro organismo primero agrupa las letras en bloques de tres
    Y luego traduce cada grupo en una letra de otro “abecedario” distinto del primero, compuesto esta vez por 20 letras y el resultado es análogo a un libro. Se obtiene un “texto” compuesto por letras, palabras, frases y párrafos.
    De modo que la cadena….
    Se traduce por
    El proceso es cientos de veces más complejo e intrincado de lo descrito anteriormente.

    La pregunta es ¿Cómo llegó a existir toda esta información?

    Los evolucionistas responden: “Por procesos naturales”

    Díganme por favor el nombre de un proceso natural (erosión, fusión, catálisis, lo que sea) capaz de concebir una serie de órdenes, escribirlas en un alfabeto de 20 letras, y traducirlas a un alfabeto de 4 letras. Díganme dónde se ha observado científicamente tal fenómeno.

    Pedro ha citado dos: autocatálisis y microevolución. Pero ninguno crea información nueva y ninguno de ellos funciona si no existe previamente la información genética.

    La pregunta es
    ¿Cómo llegó a existir toda esta información por medios naturales?
    Y en concreto ¿Qué proceso natural ha generado la información biológica?

  147. Sr. Creacionismo, se ha observado la adición de información nueva en la microevolución (causada, entre otros factores, por mutaciones genéticas). Por ejemplo:

    * increased genetic variety in a population (Lenski 1995; Lenski et al. 1991)
    * increased genetic material (Alves et al. 2001; Brown et al. 1998; Hughes and Friedman 2003; Lynch and Conery 2000; Ohta 2003)
    * novel genetic material (Knox et al. 1996; Park et al. 1996)
    * novel genetically-regulated abilities (Prijambada et al. 1995)
    * Two enzymes in the histidine biosynthesis pathway that are barrel-shaped, structural and sequence evidence suggests, were formed via gene duplication and fusion of two half-barrel ancestors (Lang et al. 2000).
    * RNASE1, a gene for a pancreatic enzyme, was duplicated, and in langur monkeys one of the copies mutated into RNASE1B, which works better in the more acidic small intestine of the langur. (Zhang et al. 2002)
    * Yeast was put in a medium with very little sugar. After 450 generations, hexose transport genes had duplicated several times, and some of the duplicated versions had mutated further. (Brown et al. 1998)
    * The process of mutation and selection is observed to increase information and complexity in simulations (Adami et al. 2000; Schneider 2000).


    Dicho de otra forma: mutaciones al azar del ADN, unidas a la selección natural (que eliminará aquellas mutaciones perjudiciales) son capaces de agregar información.

    Por supuesto, la evolución no sirve por sí sola para explicar el origen de la vida… Tampoco sirve la física nuclear para explicar cómo se forman las estrellas y nadie duda de que en las estrellas hay fusión nuclear. Incluso aunque la vida hubiera sido creada ello no invalidaría el hecho de que la evolución ha ido moldeándola desde entonces (si el Creador ha seguido presente su presencia no ha dejado huella detectable).

    Saludos cordiales

  148. Evolucionismo y Creacionismo difieren en su explicación de los ORIGENES.

    Mi pregunta no era sobre reproducción sino sobre el origen:

    ¿Qué proceso natural observado empíricamente ha ORIGINADO los miles de millones de caracteres que codifican en varios idiomas distintos las instrucciones a seguir para formar un ser vivo?

    En resumen: ¿De dónde salió el ADN? ¿De dónde salió la primera especie viva?

    La respuesta de Pedro(salvo error mío) es esta:
    “ mutaciones al azar del ADN, unidas a la selección natural (que eliminará aquellas mutaciones perjudiciales) son capaces de agregar información.”

    No Pedro, no.

    No pregunto cómo agregar información sino cómo se ORIGINA la PRIMERA información a partir de la materia inerte.

    Las mutaciones ocurren en el momento de la reproducción de los seres vivos.
    Antes de que ocurra la primera mutación debe haber existido previamente un ser vivo completamente formado, incluyendo sobre todo la complicadísima maquinaria reproductora.

    ¿Cómo se formó, por procesos naturales, la primera máquina reproductora?

    Aquella que no fue generada por un proceso reproductivo porque antes de ella no existía la reproducción.

    Pedro reconoce en su última entrada:

    “Por supuesto, la evolución no sirve por sí sola para explicar el origen de la vida…”

    Yo le felicito por su honestidad, y me pregunto..

    ¿Y ayudada de qué otra cosa sirve la evolución para explicar el origen de la vida?

    Dígame exactamente qué otro elemento surgido del método científico llevaría a un observador neutral a creer que la vida no es lo que a todas luces manifiesta ser.

    ¿Cree usted que la evolución explica el origen de todas las especies menos la primera?

    ¿Debería Darwin haber titulado su libro “El origen de todas las especies menos una”?

  149. ASAP dice:

    Antes de que ocurra la primera mutación debe haber existido previamente un ser vivo completamente formado, incluyendo sobre todo la complicadísima maquinaria reproductora.


    ¿ que es un ser vivo completamente formado ? un prión, un virus tienen mutaciones ¿ son para usted seres vivos completamente formados ? ¿ tienen una complicadísima maquinaria reproductora ?

  150. Apreciado Sr. Cracionismo, voy también a contestar la frase que ha remarcado ASAP:

    “Antes de que ocurra la primera mutación debe haber existido previamente un ser vivo completamente formado, incluyendo sobre todo la complicadísima maquinaria reproductora.”

    Veamos, si he entendido bien el modelo de ARN:
    1) se forman nucleótidos (hay una explicación bastante aceptable de cómo se forman C y U aunque aún no se sabe cómo se formaron G y A.).
    2) se ensamblan los nucleótidos en hebras “largas” de unas 50 unidades.
    3) el ARN puede tener de por sí capacidad autocatalítica, por selección natural aquellas unidades de ARN que la tuvieran más desarrollada se copiarían mejor a sí mismas. Esta es la parte del modelo que parece más débil pues no se ha conseguido (aún) “hacer evolucionar” una hebra suficientemente sencilla de ARN que tenga plena capacidad de autoreplicación. Obviamente, en cuanto aparece capacidad de autoreplicación aparecen también las mutaciones. ¿Es eso vida? Yo diría que no aunque eso depende de cómo se mire.
    4) Si se introduce el ARN en el interior de una burbuja (de lípidos) se crea una presión osmótica que hace que la “protocélula” se hinche.
    5) Cuanto más ARN contenga más se “hinchará”. Y cuanto más se “hinche” más fácil será que por simple acción del medio la protocélula se parta en dos. Obviamente, cuanto mejor sea la capacidad del ARN para autoreplicarse más fácilmente se va a “reproducir” esta protocélula.

    Y, respecto a su pregunta:
    “¿Y ayudada de qué otra cosa sirve la evolución para explicar el origen de la vida?”

    En el modelo anterior yo veo al menos los siguientes:
    -evolución (mutación y selección natural de las cadenas de ARN)
    -química (formación de los nucleótidos, formación de azúcares, formación de lípidos, formación de fosfatos, autoreplicación del ARN)
    -astronomía (probable fuente de fosfatos en meteoritos)
    -física (eliminación de nucleótidos indeseados mediante los rayos UV del Sol, convección, aplicación de frío-calor a las protocélulas, formación de esferas de lípidos)
    -geología (existencia de arcillas)


  151. ASAP parece querer decir:

    que las mutaciones no necesitan de la existencia de seres vivos que ya sepan reproducirse y cita como ejemplo un virus que, según él, tiene mutaciones supuestamente sin ser un organismo vivo.

    Wikipedia dice:

    Un virus es una entidad biológica que para reproducirse necesita de una célula huésped.

  152. ASAP dice:

    Si bien es cierto que las mutaciones más frecuentes son las que se producen durante la fase de replicación, también existen mutaciones espontáneas como la despurinización y desaminación, y otras provocadas por agentes externos como radicales superóxido y radiaciones. El que los virus requieran una célula huesped no impide que puedan mutar sin requerir la participación de la maquinaria genética de la misma.

    Imagino que es dificil hacer coexistir la ciencia con la religión en cuestiones tan complejas como el origen de la vida, pero a mi entender es más razonable mantener la hipótesis del origen abiótico de la vida que recurrir a un ‘creador’ que por definición no es falsable y por tanto hipótesis acientífica. No se puede justificar una hipótesis cientifica con un principio acientífico.


  153. Enhorabuena a Pedro por su explicación del ARN-first.
    Y lo digo sinceramente, no con cinismo.

    Y tras reconocer su mérito, presento razones para no creer esta hipótesis:


    El artículo “Origen de la vida” de Wikipedia contiene una veintena de narraciones hipotéticas similares.
    Más de 20 autodenominados “modelos” mutuamente excluyentes.
    Más de 20 diferentes equipos científicos luchando entre sí encarnizadamente, demostrando cada uno de ellos que la explicación de los otros 19 es imposible.


    Entre todas estas hipótesis cabría destacar al evolucionista y premio Nobel Francis Crick, descubridor del ADN, una autoridad en la materia y que como muchos otros evolucionistas no cree en absoluto la historieta de ARN-first ni ninguna de las otras 19.

    Para él está claro que la vida no pudo originarse en la Tierra por medios naturales. Y su hipótesis “científica” es que hubo una civilización extraterrestre, posiblemente al borde de la extinción, que decidió enviar a la Tierra unas pequeñas cápsulas que contenían bacterias. Los extraterrestres no pudieron venir debido a la larga distancia que separa su planeta de la Tierra.

    Cuando un científico de la categoría de Crick necesita recurrir a seres extraterrestres para explicar el origen de la vida, algo va muy mal en el campo evolucionista.

    Pero si la historia de Crick nos parece fantasiosa, pensemos en el ARN-first.


    La forma de vida más simple que conocemos es la bacteria.
    Tomemos una para examinarla detenidamente.
    Aumentémosla millones de veces, hasta que tome el tamaño de un avión.
    ¿Qué vemos?
    Una maravilla de la ingeniería.Que da envidia a los ingenieros aeronáuticos.
    Un fabuloso mundo de máquinas moleculares, generadores de energía, motores, camiones, cadenas de montaje etc que actúan coordinadas, al unísono, y que cumplen cada una su función precisa, como si cada máquina tuviera conocimiento de cual es su misión en el sistema, como si todo hubiera sido programado de antemano.
    Eso es lo que se observa con los más modernos microscopios.

    Ahora supongamos que podemos dar marcha atrás en el tiempo, y que llegamos al momento en el que la vida surge según una cualquiera de las muchas hipótesis abiogenéticas.

    ¿Qué vemos?
    Vemos átomos.
    Átomos que espontáneamente, dejados a sí mismos y al azar, se unen en grupos (moléculas) y que cada una de estas moléculas (ARN primero, luego otros) espontáneamente empiezan a comportarse exactamente de la forma necesaria para formar piezas sueltas las cuales, poco a poco, por sí mismas, sin dirección inteligente, por el azar de los fenómenos naturales forman máquinas mucho más eficientes que la más avanzada tecnología militar. Estas máquinas, por sí mismas, sin obedecer a inteligencia alguna, sin tener un plan previamente determinado, espontáneamente, se agrupan en sistemas que espontáneamente forman…

    ¡ un avión !.

    Un avión que, por sí mismo, sin piloto inteligente, alza el vuelo por sí mismo.
    Durante el vuelo, el avión activa un mecanismo que provoca que los átomos de sus alas empiecen el mismo proceso hasta formar dos aviones, copias idénticas del primero.

    Eso es lo que observaríamos si fuéramos testigos de la aparición de vida según esta hipótesis.


    Frente a todas estas hipótesis y especulaciones se levanta la ciencia real, la que se basa en la observación sistemática de los hechos empíricos, la que representan científicos como Louis Pasteur (y otros) que usando el método científico establecieron la “ley de la biogénesis” (Toda vida procede de la vida) demostrando que la vida no se origina espontáneamente de cosas no-vivas.

    Si todas las observaciones científicas coinciden en demostrar la biogénesis ¿Por qué los evolucionistas se empeñan en crea hipótesis en sentido contrario?

  154. ASAP dice:

    Pueden existir mil y una hipótesis que intenten explicar un fenómeno – es un hecho habitual en el mundo científico -, pero en ciencia nadie admite que Dios sea una de ellas. Para que ello fuera posible primero habría que demostrar su existencia.

    Usa deliberadamente y fuera de contexto el término ‘generación espontánea’ un concepto ya obsoleto en la ciencia. Por otra parte, es fácil de entender que cuando Pasteur se refería a la biogénesis pretendía, dado el desconocimiento científico de su época, desmentir los mitos referidos a la generación espontánea: es evidente que si en un trozo de carne descompuesta aparecen gusanos, previamente debería haber huevos; esa es la generación espontánea a la que Pasteur hacía referencia. Trasladar esta acepción clásica del término al mundo de la biología molecular y al origen de la vida es simplemente una falacia.

    Usted racionaliza una creencia intentando convencer a sus interlocutores que la ciencia es la verdad, pero que también la ciencia fue creada por la mano de Dios. Mucho me temo que si algún día se demostrase la generación de vida a partir de elementos químicos inorgánicos, su hipótesis sería que los elementos fueron creados por Dios y vuelta a empezar.

    No quiero decir que Dios no exista, como dice Jorge Wagensberg (‘Ideas acerca de la complejidad del mundo’) existen muchas formas de conocimiento, la creencia en Dios es un conocimiento intuido, pero no es un conocimiento científico. Mezclar Dios y Ciencia puede ser una buena estrategia para las Iglesias de dar un toque de ‘modernidad’ a su dialéctica ya obsoleta, pero no tiene cabida en el mundo científico: ¿ cuantas publicaciones científicas en revistas de prestigio publican estudios sobre el origen ‘divino’ de la vida ? Es cierto que un número reducido de científicos con creencias religiosas han realizado publicaciones que apoyan total o parcialmente el creacionismo, pero eso no demuestra que tengan razón, de la misma forma que pueden existir teólogos que niegen la existencia de Dios: ambos argumentos no tienen valor probatorio.

    Decir que la ciencia se basa también en ideas no probadas, para afirmar a continuación que de igual forma Dios puede ser una explicación para los fenómenos naturales y el origen de la vida, es también una falacia. Las ideas no probadas de la ciencia son hipótesis (por eso lo son) pero en ciencia cualquier hipótesis debe ser falsable, ¿ es Dios una hipótesis científica ? ¿ es falsable la existencia de Dios ?


  155. Cuatro razones para dudar de la generación espontánea de la vida mediante el ARN-first

    Ningún hecho observado nos lleva a concluir que hubo alguna vez un depósito de ribonucleótidos Beta D

    Nada en el conocimiento científico actual conduce a creer que los ribonucleótidos Beta-D formasen espontáneamente moléculas de ARN

    Nada hace suponer que una molécula de ARN, una vez formada, generara espontáneamente la actividad catalítica necesaria para replicarse a sí misma hasta formar una población de moléculas

    ¿Cómo pudo una molécula de ARN por sí misma adquirir la capacidad de generar las actividades catalíticas necesarias para sostener un ribo-organismo?

  156. Es sorprendente ver cuánto les gusta a los evolucionistas meter a Dios en discusiones que son puramente científicas.
    ASAP, en su última entrada menciona a Dios nada menos que 10 veces.
    Que yo sepa, Pedro y yo no le hemos mencionado ni usa sola vez

    Quien mezcla a Dios en el tema es ASAP y lo irónico es que lo hace para enseñarnos a los demás a que no mezclemos a Dios en el tema.

    Estas son sus palabras…

    “ Mezclar Dios y Ciencia puede ser una buena estrategia para las Iglesias de dar un toque de ‘modernidad’ a su dialéctica ya obsoleta, pero no tiene cabida en el mundo científico:”

    Por otro lado ASAP también muestra honestidad cuando reconoce que los evolucionistas no tienen demostración científica del surgimiento de la vida a partir de la materia inerte cuando escribe:

    “si algún día se demostrase la generación de vida a partir de elementos químicos inorgánicos”
    Y vuelve a ser honesto reconociendo que hay científicos no evolucionistas
    ”Es cierto que un número reducido de científicos con creencias religiosas han realizado publicaciones que apoyan total o parcialmente el creacionismo,

    • Manuel Abeledo dice:

      Por enésima vez, la teoría de la evolución no explica el surgimiento de la vida sino la especiación.

      El creacionismo, por otra parte, no explica ninguna de las dos cosas. Simplemente añade un axioma ad hoc, el de un “creador inteligente”, y apela al mal entendido sentido común para probarlo.

      Y esto, bajo ningún punto de vista, puede ser científico. Como ya he dicho antes, si nos atuviésemos al sentido común la física estaría en pañales.

      Sobre el debate, resulta muy deshonesto citar pequeños fragmentos obviando el contexto. Pero no se puede esperar otra cosa, supongo.

  157. Manuel, has llegado a la conclusión a la que yo quería llegar:

    La evolución no explica el origen de la vida.

    Pero no por falta de ganas, porque

    1/ Darwin sí propuso una explicación del origen de la vida (sopa primordial, 1871)

    2/ Los evolucionistas modernos muestran mucho empeño (más de 20 teorías) en explicar que la vida se genera espontáneamente a partir de la materia inerte por medio de fenómenos puramente físicos sin guía de ninguna clase.

    La evolución no explica el origen de la vida porque la evolución sólo admite mecanismos naturales y la ciencia muestra que la vida no puede surgir por mecanismos naturales.


    La evolución no explica el origen de la vida.

  158. Manuel dice que la evolución explica la especiación.

    Bien, vamos a contrastar nuevamente la teoría con los datos empíricos observados en la realidad, que así es como funciona el método científico ¿no?

    Supongamos que ha surgido la vida espontáneamente de una forma misteriosa que no explicamos.

    Muy bien.

    ¿Qué pasa ahora?

    Los evolucionistas dicen que la vida empezó con una célula simple.

    Las observaciones científicas muestran que no existen células simples. Darwin y sus contemporáneos no tenían ni idea de lo que hay en el interior de la célula y creían que era un simple globo de protoplasma, como una bolita de arcilla con la cual se puede modelar cualquier cuerpo.

    Nada más lejos de la realidad empírica que la ciencia ha descubierto

    Lo que hoy observamos es que existen tres grupos de seres unicelulares (procariotas, eubacterias y arqueobacterias) los cuales difieren entre sí tanto como un mamífero de un reptil.

    Los tres grupos presentan tantas diferencias que ningún evolucionista ha conseguido explicar cómo uno haya podido evolucionar a partir del otro. Al mismo tiempo comparten el mismo código genético lo cual hace increíble la hipótesis de una generación independiente.

    ¿Puede algún evolucionista explicarnos por favor qué relación filogénica hay entre la primera forma de vida y los tres distintos grupos monocelulares observados en el laboratorio ?

    ¿Cómo han llegado a la conclusión de que procariotas, eubacterias y arquobacterias han evolucionado ?

    Dicho de otra forma:

    Dado que la evolución explica la especiación…

    ¿Cómo se dio la primera especiación en el mundo monocelular?¿ Son los tres hijos de la madre de todas las células? ¿ Son hijos los unos de los otros? ¿O surgieron cada uno de ellos independientemente de los otros dos?

    • Manuel Abeledo dice:

      Lo que hoy observamos es que existen tres grupos de seres unicelulares (procariotas, eubacterias y arqueobacterias) los cuales difieren entre sí tanto como un mamífero de un reptil.

      … Siempre que no tengas en cuenta, no sé, ¿la endosimbiosis? Y nadie ha conseguido explicar las diferencias… ¿Margulis es “nadie”?

      Creo que voy entendiendo cuáles son tus problemas. Por una parte ignoras la literatura científica, ya no la especializada sino la divulgativa. Por otra, asumes que cualquier evento desconocido dentro del marco de una teoría es automáticamente una “evidencia en contra”.

      Lo cual resultaría en la siguiente paradoja. Dado que nadie ha podido probar sin lugar a dudas y sin acudir a ese mal entendido “sentido común” del que se vanaglorian los creacionistas, que existe un ente creador de todo… es que no existe.

      Para más INRI, dicho ente incurre en otras paradojas lógicas que no voy a comentar. Simplemente no se ajusta a una perspectiva científica.

  159. ASAP dice:

    Exacto, la evolución no explica el origen de la vida, tampoco DIOS.

    Porque un creacionista creyente usa eufemismos como ‘agente inteligente’ para referirse a DIOS. ¿ Le da verguenza que el confundan con un vulgar creyente ?

    Por cierto, no existen tres grupos de seres unicelulares las eubacterias y arqueobacterias son procariotas. Revise sus apuntes de microbiología.


  160. Sí, es cierto, me equivoqué en la nomenclatura.
    Aquí va mi corrección…

    Las células se dividen en tres grupos llamados eucariotas, arqueobacterias y eubacterias.

    La evolución, que según los evolucionistas es un hecho tan probado como la gravedad explica los mecanismos que transformaron la nunca observada científicamente primera célula en los 3 grupos actuales.

    Los evolucionistas pretenden hacernos creer que esta afirmación (que los tres grupos evolucionaron) surge del estudio científico y no de su fe (creencia) en la teoría.

    Bien, pues que alguien explique qué evidencias científicas, qué hechos empíricos, qué observaciones verificables han llevado a los evolucionistas a CREER que los 3 grupos evolucionaron a partir de otro.

    ¿Qué se observa en estos grupos al estudiarlos científicamente?

    Se observan 3 cosas:

    (1) Son tan distintos entre sí que es científicamente imposible que uno haya evolucionado a partir de otro.
    Esto lo reconoce hasta la Wikipedia (no yo) cuando dice:

    “estas diferencias son mayores de las que hay, por ejemplo, entre una planta y un animal”

    Por tanto, decir que uno de los grupos evolucionó a partir de otro es como decir que los animales evolucionaron a partir de las plantas.

    (2) Son tan distintos entre sí que es imposible concebir un antepasado común.

    No se observa en la naturaleza ningún ser vivo que pudiera ser un antepasado común de los 3 grupos monocelulares.
    No hay evidencias empíricas de que tal supuesta criatura haya existido jamás.
    Tan solo existen CREENCIAS, tal como reconoce la Wikipedia:

    “Se CREE que todos los organismos que existen actualmente derivan de una forma unicelular procariótica”

    (3) Son tan parecidos entre sí que parecen haber surgido de un origen común.

    A pesar de ser tan distintos como las plantas lo son de los animales, los 3 grupos monocelulares comparten su código genético. El ADN. Es decir, que han sido escritos en el mismo idioma.

    Estos son los hechos.
    Estos son los datos.

    ¿Qué ven los evolucionistas en estos datos (u otros observados empíricamente) que les lleve a creer, con fe inquebrantable, que seres que son tan distintos como plantas los son de los animales han evolucionado el uno del otro?

  161. ASAP dice:

    Hay numerosos estudios sobre el origen de los eucariotas desde la perspectiva evolucionista. El que ninguna sea concluyente no quiere decir que la ciencia falle, simplemente todavía no hay pruebas suficientes para que el cuerpo científico se decante por alguna de ellas. Vea por ejemplo:


  162. ¿Cómo dice ASAP?

    ¿Qué no hay estudios concluyentes sobre el origen de los seres más simples?
    ¿Qué no hay pruebas suficientes?

    A ver si lo comprendo…

    Recapitulemos brevemente…

    CAPITULO 1 – De la materia inerte a la vida.

    Los evolucionistas creen en una teoría sobre le origen de las especies que, según ellos reconocen, no explica el origen de la primera especie (Luca).

    Al preguntar sobre el origen de Luca se nos responde con 20 hipótesis distintas, contradictorias y autoexcluyentes, es decir que por cada científico que defiende una de ellas hay 19 científicos que la niegan.

    Estas 20 explicaciones son de lo más variopinto y van desde la supuesta existencia de diseñadores inteligentes extraterrestres (Panspermia) al surgimiento (generación) sin intervención externa (espontánea) de seres vivos a partir de la materia inerte.

    Todos estamos de acuerdo en que a Luca nadie lo ha visto jamás. Todavía pertenece al reino de lo imaginario.

    Es más, ningún hecho observado empíricamente con el método científico conduce a pensar que los átomos tienen la tendencia espontánea a escribir las millones de instrucciones de ensamblaje y funcionamiento que vemos en los seres vivos.

    Tampoco se observa empíricamente que los átomos, por sí mismos, empiecen a construir máquinas de traducción automática para traducir instrucciones de un idioma de 4 letras a otro idioma de 20 letras, para luego, siguiendo estas instrucciones, construir un ser tan complejo como un portaaviones que incluya en su interior otra vez las millones de instrucciones de montaje esta vez retraducidas del idioma de 20 letras al de 4.

    Pero la fe evolucionista permanece inquebrantable y al igual que un niño está convencido de que los nunca observados empíricamente Reyes Magos de Oriente le han traído el Scalectric, los evolucionistas están persuadidos de que su jamás observado empíricamente Luca es el que les ha traído las células que forman la vida.

    Pregúntale a un evolucionista de dónde viene su fe en la evolución de la vida a partir del polvo de la tierra y te acusará a ti de tener fe en la creación de la vida a partir del polvo de la tierra.

    CAPITULO 2 – De Luca a la bacteria.

    Darwin creía que las células eran globos de protoplasma, bolitas de arcilla usadas por la naturaleza para formar los cuerpos de los animales y propuso una teoría que debería explicar la evolución de los tres tipos de células que vemos hoy.

    Gracias a la observación de los datos objetivos la ciencia ha demostrado que la concepción Darwinista de la célula es falsa.

    Oigamos la voz de la ciencia…

    La célula al igual que el cuerpo humano tiene órganos (cerebro, pulmones, estómago). Los órganos de la célula igual que los órganos de un hombre ejecutan cada uno de ellos una función precisa, específica y planeada (alimentación, reproducción, excreción).

    Cada órgano celular consiste en una interconexión de sistemas que cooperan entre sí. Cada uno de estos sistemas posee una exquisita sofisticación jamás conseguida por ningún ingeniero humano. Dentro de cada órgano (orgánulo) las tareas necesarias son ejecutadas por máquinas.

    Sí, sí. Máquinas, diminutas máquinas moleculares.

    Máquinas construidas con los mismos materiales (átomos) que el motor de un choche. Máquinas que necesitan energía para funcionar igual que una lavadora. Se han observado máquinas de muchos tipos distintos; motores, propulsores, rotores, transportadores, generadores eléctricos, etc..

    Todas las máquinas están sincronizadas entre sí, como los músicos de una orquesta ejecutan al unísono una sinfonía, como si obedecieran las órdenes de un director invisible, como cumpliendo de un plan previamente concebido por un ser inteligente que ha concebido todos los detalles, que ha calibrado los millones de tuercas, tornillos, muelles y rodamientos para que todos cooperen a conseguir un objetivo único.

    Quiero dirigir una pregunta a ASAP, a Manuel y a Pedro. Y me permito tutearos porque a estas alturas ya somos “amigos”:

    ¿Qué procesos naturales observados según el método científico te ha llevado a ti, a ti particularmente, a tu convicción de que los átomos por sí solos construyen piezas que por sí solas construyen máquinas que por sí solas se agrupan en sistemas que por sí solos forman orgánulos que por sí solos ejecutan instrucciones que ellos mismos escriben en dos idiomas distintos y que dan lugar a las miles de tareas necesarias para sustentar un ser vivo más pequeño que milésima de milímetro?

    Cuando respondas te propondré que hablemos del siguiente capítulo de esta fascinante serie:

    CAPITULO 3 – De la vida monocelular a la multicelular.

  163. Manuel Abeledo dice:

    Y vuelta la burra al trigo.

    ¿Qué proceso natural da lugar, a partir de átomos y moléculas, a cristales con formas geométricas perfectamente definidas? ¿Eso también ha sido diseñado?

    Vuelvo a repetir que tus dudas son en su mayoría producto de la ceguera selectiva, y de ningún modo constituyen contraejemplos. Lo de las “máquinas” es otro ejemplo del mal entendido “sentido común”, analogías erróneas que los creacionistas seguís utilizando como si tuviesen validez… pero no es así.

    Que sólo podais entender el mundo desde la perspectiva que os otorgan vuestros prejuicios, no significa que sean ciertos.

  164. Manuel pregunta:
    ¿Qué proceso natural da lugar, a partir de átomos y moléculas, a cristales con formas geométricas perfectamente definidas?

    Yo respondo
    Reajuste del pH
    Repentina bajada de la temperatura
    Cambio en la naturaleza del solvente

    Pero aunque no fueran estos, eso no importa. Porque nadie pone en duda que existen procesos naturales que formen cristales.
    Todos estamos de acuerdo que sí se forman por procesos naturales.
    En lo que no estamos de acuerdo es en la formación del primer ser vivo; la evolución afirma que fueron procesos naturales y yo quisiera saber

    ¿qué proceso exactamente?

    ¿la formación de cristales?

    ¿Es el proceso de formación de cristales por evaporación lo que te ha llevado a ti, a ti Manuel, a tu convicción de que los átomos por sí solos construyen piezas que por sí solas construyen máquinas que por sí solas se agrupan en sistemas que por sí solos forman orgánulos que por sí solos ejecutan instrucciones que ellos mismos escriben en dos idiomas distintos y que dan lugar a las miles de tareas necesarias para sustentar un ser vivo más pequeño que milésima de milímetro?

    • Manuel Abeledo dice:

      Entonces sí existe un proceso natural que, bajo un punto de vista humano, “ordena” un conjunto de moléculas.

      Vuelvo a lo de antes, por tercera vez: que no se conozca exactamente (porque hay varias hipótesis y experimentos disponibles para su consulta) cuál es el proceso que, partiendo de materia inorgánica, da lugar a la vida, no significa que el creacionismo sea una opción viable. Y no lo es porque no es falsable, no es una opción científica, es una hipótesis ad hoc sobre algo que no existe o no podemos saber que existe.

      Es más, plantear dudas acerca del surgimiento de la vida no afecta en nada a la teoría de la evolución, que explica la especiación.

  165. Dice Manuel que…
    Lo de las “máquinas” es otro ejemplo del mal entendido “sentido común”, analogías erróneas que los creacionistas seguís utilizando como si tuviesen validez… pero no es así.

    Yo no respondo nada, invito a todo el mundo a que lea el artículo “Máquinas Moleculares” en cualquier enciclopedia.

    Por ejemplo la Wikipedia:

    Desde una perspectiva de síntesis, hay dos importantes tipos de máquinas moleculares: interruptores moleculares (o lanzaderas) y motores moleculares. La principal diferencia entre los dos sistemas es que un cambio influye en un sistema como una función de Estado, mientras que un motor de un sistema de influencias en función de la trayectoria. Un switch (o servicio) pueden aparecer a someterse a traslacional moción, pero un cambio de regresar a su posición original deshace cualquier efecto mecánico y libera energía en el sistema. Además, los interruptores no pueden utilizar la energía química a la utilización repetitiva de la unidad y progresivamente un sistema fuera de equilibrio donde un motor puede.

  166. ASAP dice:


    Siento decir que esta línea del blog no nos lleva a ninguna parte, porque ni aclaramos nada a los posibles lectores (que entiendo ajenos a la mayoría de los términos y teorías a debate) ni conseguimos llegar a un punto de acuerdo sobre aspectos fundamentales de la ciencia. Creo que tanto Pedro Anguita, como Manuel Abeledo han hecho aportaciones valiosas al debate, siempre desde la moderación y la perspectiva científica.

    Mi punto de vista, que creo coincidente con el de Pedro y Manuel, está dentro de lo que se podría entender como ortodoxia científica:

    1. La ciencia no afirma ni niega la existencia de Dios (llámale como quieras) simplemente ignora este debate porque de acuerdo al método científico no se puede demostrar una hipótesis no falsable.

    2. Una hipótesis no falsable, mito, creencia no puede plantearse científicamente como causa de un fenómeno natural.

    3. Luego, la ciencia estudia los fenómenos naturales partiendo de conceptos, hipótesis, leyes o paradigmas acordes con el método científico-deductivo que está sobradamente asentado y especificado en cualquier disciplina científica.

    4. En relación al creacionismo, de nuevo dentro del marco de la ciencia, afirmar que existe un ‘agente inteligente’, ‘primum mobile’ o cualquier cosa que existe antes que nada y que justifica el todo, es como volver a la época donde se pensaba que la tierra era plana. Incluso dentro de EEUU, donde ciertas corrientes religiosas han hecho causa del creacionismo, las sociedades científicas de ámbito internacional han realizado publicaciones aclarando el punto de vista inequívoco de la ciencia al respecto: la evolución está suficientemente demostrada y no es motivo actual de debate científico en cuanto a sus principios fundamentales

    5. La ciencia es una forma de conocimiento ‘relativo’, no existen verdades absolutas, sino un intento de explicación de la realidad, más o menos ajustadas a la misma, y que pueden cambiar en el momento que se obtenga una nueva hipótesis más acertada o se false una existente.

    6. Un modelo de conocimiento basado en una verdad absoluta como es la existencia de un ‘ser superior’ es totalmente acientífica. Intentar combinar Ciencia y Creencia es poco más que un ejercicio dialéctico, que sólo se justifica desde la perspectiva individual de un creyente con formación científica – como en su caso – pero que no deja de ser una ‘rara avis’ en el contexto actual del conocimiento científico.

    7. A estas alturas creo que nadie discute en ciencia que evolución y origen de la vida son cosas bien distintas, si bien el paradigma evolucionista permite plantear algunas hipótesis del origen de la vida basándose en un modelo evolutivo. El que existan 20 o 2000 hipótesis sobre el origen de la vida demuestra la riqueza y validez del método científico, en ningún caso valida la hipótesis del creacionismo (o las decenas de hipótesis creacionistas según que religión tengamos en consideración)

    8. Usar como usted hace razonamientos basados en el ‘sentido común’, el ‘es evidente’ ,… etc es caer en el terreno de la falacia, más próximo al proselitismo de cualquier doctrina religiosa que a la meticulosidad y objetividad el método científico.


  167. Creo que mi pregunta:
    ¿Qué proceso natural ha generado la información biológica?

    Ha provocado dos respuestas..

    Una estructura cristalina, por ejemplo, contiene información que responde a las propiedades fisico-químicas del material

    Entonces sí existe un proceso natural que, bajo un punto de vista humano, “ordena” un conjunto de moléculas.


    Me permito exponer las razones científicas que muestran que una estructura cristalina es incapaz de originar información biológica.

    Un cristal es una disposición repetitiva (y ordenada) de átomos.
    Pero su estructura no tiene más información que cualquiera de sus moléculas. Porque la información del cristal ya está presente en sus componentes básicos; por ejemplo, las fuerzas direccionales entre átomos.
    Una estructura cristalina se asemeja a una cadena de letras que repite el mismo patrón.


    La información que crea la vida (el ADN) se compone de secuencias especificadas como


    Si descomponemos una formación cristalina en sus componentes básicos vemos que cada uno de ellos (letra A) contenía ya la información de su conjunto.

    Si descomponemos una cadena de ADN en componentes vemos que la información desaparece (letra A, letra O, letra M, letra R).
    ¿Por qué?

    Porque la información NO ESTA EN LAS LETRAS. La información esta en el DISPOSICION ESPECIFICADA de las letras
    Si disponemos las letras de una forma (AMOR) comunicamos una idea.
    Si disponemos las letras de otra forma (ROMA) comunicamos otra idea distinta.

    En ROMA y AMOR tenemos las mismas letras, pero distintas información

    ¿Cómo es posible que las mismas letras comuniquen distinta información?

    Porque la información surge de la DISPOSICION ESPECIFICADA y no de las letras.

    Una palabra tiene más información que la suma de la información de sus letras.
    La información no es una entidad material y por eso no puede ser creada por un proceso material.
    Es más la información siempre tiene un autor inteligente y un destinatario inteligente.

    ¿Qué proceso natural ha generado la información biológica?

    ¿la cristalización?

    El prominente evolucionista Leslie Orgel, dice:
    “Los seres vivos se distinguen por su complejidad especificada. Los cristales como el granito no son aptos para ser clasificados como seres vivos porque les falta complejidad; las mezclas de polímeros aleatorios no pueden clasificarse como vivos porque les falta especificación.”

  168. Dice ASAP——————————————

    1. La ciencia no afirma ni niega la existencia de Dios (llámale como quieras) simplemente ignora este debate porque de acuerdo al método científico no se puede demostrar una hipótesis no falsable.


    Estoy plenamente de acuerdo
    ¿Por qué no dejan ustedes de hablar de Dios de una vez y responden a mis preguntas científicas con evidencias concretas?
    Yo no he mencionado a Dios ni una sola vez, son ustedes los únicos que le mencionan.

    Dice ASAP——————————————

    2. Una hipótesis no falsable, mito, creencia no puede plantearse científicamente como causa de un fenómeno natural.


    Estoy plenamente de acuerdo
    El verdadero científico busca las causas de un fenómeno natural (información biológica) estudiando las características de ESTE fenómeno natural.
    El verdadero científico razonará así:
    “Dado que las características de la información biológica son tal y cual, su origen debe haber sido tal y cual”

    El verdadero científico fundamenta sus conclusiones en las características observadas en la naturaleza.
    Por eso mi pregunta es ¿Qué característica de la información biológica hace pensar que ésta ha evolucionado?
    Y el evolucionista no tiene respuesta
    ¿Sabe usted por qué?
    Pues porque una hipótesis no falsable, mito, creencia no puede plantearse científicamente como causa de un fenómeno natural.

    Dice ASAP——————————————

    3. Luego, la ciencia estudia los fenómenos naturales partiendo de conceptos, hipótesis, leyes o paradigmas acordes con el método científico-deductivo que está sobradamente asentado y especificado en cualquier disciplina científica.


    Estoy plenamente de acuerdo
    Y el objetivo de la ciencia es describir las leyes de la naturaleza.
    Una ley no es como una hipótesis o como un paradigma sino que es una proposición confirmada por todas las observaciones y experimentos sin una sola excepción
    La biogénesis es una LEY porque la confirman todas las observaciones y experimentos y no la niega ninguno.
    Por el contrario la Abiogénesis es una HIPOTESIS que no surge de ninguna observación ni de ningún experimento.
    O si no dígame
    ¿Qué hecho empírico salido del método científico conduce a establecer la abiogénesis?

    Dice ASAP——————————————

    4. En relación al creacionismo, de nuevo dentro del marco de la ciencia, afirmar que existe un ‘agente inteligente’, ‘primum mobile’ o cualquier cosa que existe antes que nada y que justifica el todo, es como volver a la época donde se pensaba que la tierra era plana.


    ¿Quiere que le haga una lista de las disciplinas científicas que fueron fundadas por científicos que sostenían tal afirmación?

    Dice ASAP——————————————

    Incluso dentro de EEUU, donde ciertas corrientes religiosas han hecho causa del creacionismo, las sociedades científicas de ámbito internacional han realizado publicaciones aclarando el punto de vista inequívoco de la ciencia al respecto: la evolución está suficientemente demostrada y no es motivo actual de debate científico en cuanto a sus principios fundamentales


    En ciencia se razona a partir de los datos empíricos.
    En religión a partir de las Sagradas Escrituras pues estas contienen las verdades eternas indiscutibles e incuestionables dadas por los profetas.

    ¿ Quién en este debate es el que hace referencias a ciertas Escrituras
    (“han realizado publicaciones”)
    que contienen verdades
    (“el punto de vista inequívoco de la ciencia”)
    (“está suficientemente demostrada”)
    e incuestionables
    (“no es motivo actual de debate científico”)
    dadas por los profetas
    (“las sociedades científicas de ámbito internacional”) ?


    Dice ASAP——————————————

    6. Un modelo de conocimiento basado en una verdad absoluta como es la existencia de un ’ser superior’ es totalmente acientífica. Intentar combinar Ciencia y Creencia es poco más que un ejercicio dialéctico, que sólo se justifica desde la perspectiva individual de un creyente con formación científica – como en su caso – pero que no deja de ser una ‘rara avis’ en el contexto actual del conocimiento científico.


    Le propongo realizar un experimento:

    1/ Escriba usted en un papel su posición científica
    2/ Escriba usted en otro papel su posición religiosa (o atea)
    3/ ¿Hay alguna relación entre ellas? Por ejemplo ¿Se fundamentan las dos en el materialismo?
    4/ No me responda jamás a la pregunta 3, respóndase usted a sí mismo.

  169. ASAP dice:


    Hace usted una ‘eiségesis’ muy peculiar de la ciencia en general y del evolucionismo en particular.

    ‘¿Qué característica de la información biológica hace pensar que ésta ha evolucionado?’

    La evolución está perfectamente demostrada a todos los niveles y si tiene dudas sobre aspectos de la evolución a nivel de biología molecular existen numerosos estudios científicos que la confirman.

    Pretender demostrar que la evolución no existe basándose en que todavía no se ha encontrado ‘el primer ser vivo’ o que en el laboratorio no se ha conseguido sintetizar un ácido nucleico a partir de elementos inorgánicos es un falacia. Esto sólo demuestra que desconocemos el origen de la vida y por ello existen diversas hipótesis de trabajo.

    Hasta el momento, usted sólo ha atacado la evolución basándose en las propias dudas que los científicos se plantean sobre algunos de sus aspectos más complejos y todavía no totalmente aclarados. De nuevo, que la ciencia se plantee dudas sobre aspectos puntuales de una teoría no la invalida.

    Como todavía no ha planteado usted ninguna hipótesis clara, voy a hacer el esfuerzo de intentar descubrir que es lo quiere decir. Según usted:

    1. La vida sólo puede surgir de la vida
    2. Ergo, o la vida ha existido siempre o existe un ‘agente inteligente’ al que llamaremos ‘el innombrable’ que la crea
    3. La vida no evoluciona, cualquier nueva forma de vida o especie es la consecuencia de un ‘plan inteligente’
    4. La información de este plan y los detalles exactos de la creación de las nuevas formas de vida está contenida en el material genético desde el propio inicio de la vida.
    5. Luego ‘el inombrable’ existe antes que la vida y ha diseñado un plan inteligente que conduce a la aparición de nuevas especies de una manera programada en el lenguaje genético

    ¿ es esa su teoría ? A ver si nos aclaramos, porque al final esto va a ser una conversación de besugos.


  170. Dice ASAP:

    “La evolución está perfectamente demostrada a todos los niveles”


    Sí. Eso no lo duda nadie. La microevolución (variaciones dentro de un mismo género) es un hecho visible tan claro que ni siquiera necesita demostración. Simplemente se observa, se constata.
    La microevolución ha llegado incluso a producir poblaciones que no hibridizan entre sí (Hawai)
    Lo que discutimos no es la existencia de la evolución sino su capacidad de generar nuevos géneros taxonómicos.

    Dice ASAP:

    y si tiene dudas sobre aspectos de la evolución a nivel de biología molecular existen numerosos estudios científicos que la confirman.


    No tengo “dudas sobre aspectos” tengo la convicción científica de su absoluta y total falsedad. Yo no critico “ciertos aspectos” sino TODOS los aspectos.
    No hay
    ni una sola evidencia sólida de la evolución de luca a los monocelulares,
    ninguna evidencia de evolución de monocelulares a multicelulares,
    ninguna evidencia de antepasados evolutivos de hongos, esponjas, insectos, peces, y una docena de phyla más
    ninguna evidencia del paso de pez a anfibio ni de anfibio a reptil, ni del reptil a ave ni de reptil a mamífero, ni de mamíferos terrestres a mamíferos marinos y voladores
    ningún antepasado evolutivo de ninguna clase orden familia o género
    ninguna secuela de evolución de órganos complejos como el radar del murciélago o el sifón de la ballena.
    ninguna secuela de evolución de sistemas como la visión, la reproducción o el vuelo
    Pero si tuviera que escoger un solo aspecto en el que se viera con más claridad la falsedad de la evolución escogería el mismo que usted escoge: la biología molecular.

    Dice ASAP:

    ….sobre aspectos de la evolución a nivel de biología molecular existen numerosos estudios científicos que la confirman.


    Falso. Y la prueba es que los evolucionistas jamás citan nunca un estudio concreto, una evidencia específica, un fenómeno observable o una cualidad empírica.
    Ustedes tan solo hacen vagas referencias a ciertas Sagradas Escrituras (estudios científicos) que contiene la verdad absoluta y por tanto son incuestionables.
    Pero en ciencia no vale hacer referencia a escritos inerrantes, lo que vale son los hechos objetivos observados, medidos, cuantificables y cuantificados, según el método científico.
    Sin saber a qué estudios biomoleculares se refiere me arriesgare a adelantar que las distancias moleculares expresan relacionas cladísticas y no filogenéticas.

    Dice ASAP:

    Pretender demostrar que la evolución no existe basándose en que todavía no se ha encontrado ‘el primer ser vivo’


    Mea culpa. No me he expresado bien.
    Pretendo dejar patente que la naturaleza es discontinua. Que no existe la progresión lenta y gradual que llevaría de los seres simples a los complejos. Pretendo unirme al ejército de los evolucionistas que niegan el principio darwinista “Natura non facit saltum”

    Dice ASAP:

    Pretender demostrar que la evolución no existe basándose en que todavía no se ha encontrado ‘el primer ser vivo’


    Pretendo desenmascarar la expresión “origen de la vida” porque es un término abstracto que nos impide ver lo difícil que es que la vida se origine de la materia inerte. Por eso insisto en hablar del origen del primer ser vivo.
    Usted estará de acuerdo que, incluso si la abiogéneses fuera cierta lo que surgió fue un ser vivo muy concreto, observable en el laboratorio.
    Dice ASAP:

    Pretender demostrar que la evolución no existe basándose en que todavía no se ha encontrado ‘el primer ser vivo’ o que en el laboratorio no se ha conseguido sintetizar un ácido nucleico a partir de elementos inorgánicos es un falacia. Esto sólo demuestra que desconocemos el origen de la vida y por ello existen diversas hipótesis de trabajo.


    Sí. 99 % de acuerdo.
    El hecho de que no hayamos encontrado el primer ser vivo no prueba que no existiera.
    Pero mi razonamiento no es ese (otra vez mea culpa si no me he expresado bien) Lo que yo me esfuerzo por demostrar es la imposibilidad de la transformación de materia inerte en seres vivos. Y el argumento principal no es la inexistencia de evidencias sino la información. La vida ES información y la información no surge por sí sola.
    Dice ASAP:

    Hasta el momento, usted sólo ha atacado la evolución basándose en las propias dudas que los científicos se plantean sobre algunos de sus aspectos más complejos y todavía no totalmente aclarados. De nuevo, que la ciencia se plantee dudas sobre aspectos puntuales de una teoría no la invalida.


    De acuerdo completamente en su última frase.
    Sin embargo no estoy de acuerdo en que mi ataque se refiera a “sobre algunos de sus aspectos más complejos” creo que mis críticas se dirigen al corazón mismo de la teoría. Y por “corazón” entiendo el binomio variación-selección.
    Yo niego la existencia de mecanismos naturales capaces de generar la información biológica que la macroevolución requiere.
    Dice ASAP:

    Como todavía no ha planteado usted ninguna hipótesis clara, voy a hacer el esfuerzo de intentar descubrir que es lo quiere decir


    Me quedo con la boca abierta
    Lo que hace ASAP aquí es exactamente lo correcto. Intentar comprender al otro.
    En consecuencia yo estoy obligado a intentar responderle, aquí va la respuesta…


    LA VIDA ES INMATERIAL, los seres vivos son la expresión física de conceptos inmateriales.
    Intento expresarlo con una analogía…
    Darwin tuvo una idea.
    Darwin quiso expresar su idea.
    Podría haber pintado un cuadro, podría haber grabado un mp3, podría haber hecho una película, podría haber expresado su idea utilizando diversas expresiones físicas (pintura, voz, etc)

    Darwin expresó su idea utilizando el lenguaje.

    Usó un idioma (inglés) su vocabulario, su sintaxis y su gramática.
    Dispuso la materia (los átomos que formaban la tinta con la que escribió) en forma de rayas sobre un papel siguiendo patrones muy precisos (letras, palabras, párrafos), de forma que nosotros, al estudiar la disposición física los trazos de la tinta en el papel podamos replicar en nuestra mente su idea.

    Hoy, aunque no sepamos inglés, vemos sus libros y concluimos que fueron originados por ideas.

    El código genético es el idioma en el que está escrita la constitución física de todos los seres vivientes. Las letras, palabras, frases y párrafos son la materialización de ideas inmateriales.

    La ciencia no puede detectar estas ideas inmateriales de la misma forma que ningún estudio científico de las obras de Darwin puede demostrar que Darwin existió porque la ciencia se circunscribe a los fenómenos físicos materiales y un conjunto de trazos en un papel son simplemente un conjunto de trazos en un papel.

    El método científico que estudia una creación (un libro o una célula) no puede identificar a su creador (Darwin / Dios) porque el método científico se limita al mundo físico y el origen de estas creaciones (el libro, la célula) es intelectual. Libros y células son ideas concebidas por mentes inteligentes y expresadas mediante disposiciones complejas de átomos.

    Pero sí podemos concluir que libros, canciones, poemas, ideologías y células son expresiones de ideas. La ciencia no identifica al autor pero sí puede decirnos muchas cosas de las características de este autor.

  171. jose dice:

    jajajaja sabia que eras ateo.

  172. Alicia dice:

    ja ja ja, parece que eres quien dicta todos los temarios en los colegios!!!!!

    ¿no te enseñaron a pensar con autonomía? pero es que aún te sigues creyendo lo de DARWIN??????????

    Si además tomas a DIOS como un ser paranormal equiparable a un fantasma, MADRE MIA QUE CACAO TIENES EN LA CABEZA. Soy tan ofensivo como reacción a tales barbaridades, y para así picar a tu ego y comenzar un debate en condiciones.
    Quien crea las reglas del juego no puede ser una ficha del mismo, ¿lo entiendes? o es que te imaginas al CREADOR con aspecto, con órganos y bajo leyes físicas y químicas???? acaso seguimos en la edad media? o es que hacemos caso a los gilimedios….

  173. Alicia dice:

    a veces veo un OPUS VS SOCIOALISM, pero recuerdo algunos hechos y pienso EGO VS LIBERTAD ¿con qué grupo estás?

  174. continue dice:

    It is appropriate time to make some plans for the long run and it’s time to be happy. I’ve
    learn this submit and if I could I want to suggest you few
    fascinating issues or suggestions. Maybe you could write subsequent articles
    regarding this article. I desire to read more things about it!


Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

A %d blogueros les gusta esto: